Rw6G031650

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0000691
Physical Location & Seq
Forward (+)
55771322 .. 55772269
948 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G031650.1

Sequence Viewer

Length: 384 bp
ATGCTTGCCTATGAGCCTGCTATAAATCCTATTCCAGGTGTTCACGAGTGGGATGTAGTGGAGAAGCCAATTATACCTCCAAAATACACAAGGGGACCTGTCAGACCCAAATTGTCAAGAAATAAGGAACCAGGTGAATTACCACCACCTGCTGGAGCTACAAAGTTACCTAAAAGCTATTATTCTAAAGTCACATGTTCTAAGTGTAAAAAGGAGGGCCATAATACGAGAACATGTGGCAAGAGAAATGGTCAAGCCAACGTTACTCAATTTGGGGTTGAAGCTCAAAATGTTAACCAAGTTGATAATTCTGATAATCCACCTATGAGGTCTGACTCTATTAAAGGACCAAAAGATGCCAACAAGAAGGTTTGGAGGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

127

Amino Acids

14.07

Weight (kDa)

9.71

Isoelectric Point (pI)

28.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 157
Acc36I ACCTGC 1 cut(s) 157
AccB7I CCANNNNNTGG 1 cut(s) 152
AclI AACGTT 1 cut(s) 261
AfiI CCNNNNNNNGG 2 cut(s) 35, 152
AflIII ACRYGT 2 cut(s) 194, 233
AgsI TTSAA 1 cut(s) 281
AjnI CCWGG 2 cut(s) 34, 130
AluBI AGCT 3 cut(s) 158, 177, 284
AluI AGCT 3 cut(s) 158, 177, 284
AoxI GGCC 2 cut(s) 217, 377
AspS9I GGNCC 3 cut(s) 95, 217, 347
AsuHPI GGTGA 1 cut(s) 146
AvaII GGWCC 2 cut(s) 95, 347
BauI CACGAG 1 cut(s) 44
BciT130I CCWGG 2 cut(s) 36, 132
BfuAI ACCTGC 1 cut(s) 157
Bme1390I CCNGG 2 cut(s) 36, 132
Bme18I GGWCC 2 cut(s) 95, 347
BmgT120I GGNCC 3 cut(s) 95, 217, 347
BmiI GGNNCC 2 cut(s) 96, 129
BmrFI CCNGG 2 cut(s) 36, 132
BmsI GCATC 1 cut(s) 346
BpmI CTGGAG 1 cut(s) 174
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 152
BseBI CCWGG 2 cut(s) 36, 132
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 35, 152
BshFI GGCC 2 cut(s) 219, 379
BslFI GGGAC 1 cut(s) 108
BslI CCNNNNNNNGG 2 cut(s) 35, 152
BsmFI GGGAC 1 cut(s) 108
BsnI GGCC 2 cut(s) 219, 379
BspANI GGCC 2 cut(s) 219, 379
BspLI GGNNCC 2 cut(s) 96, 129
BspMI ACCTGC 1 cut(s) 157
BssSI CACGAG 1 cut(s) 44
Bst2BI CACGAG 1 cut(s) 44
Bst2UI CCWGG 2 cut(s) 36, 132
BstC8I GCNNGC 2 cut(s) 6, 18
BstDEI CTNAG 1 cut(s) 201
BstENI CCTNNNNNAGG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 58
BstNI CCWGG 2 cut(s) 36, 132
BstNSI RCATGY 2 cut(s) 198, 237
BstSCI CCNGG 2 cut(s) 34, 130
BsuRI GGCC 2 cut(s) 219, 379
BtsCI GGATG 1 cut(s) 58
BveI ACCTGC 1 cut(s) 157
Cac8I GCNNGC 2 cut(s) 6, 18
Cfr13I GGNCC 3 cut(s) 95, 217, 347
CsiI ACCWGGT 1 cut(s) 130
CviAII CATG 2 cut(s) 195, 234
CviJI RGCY 8 cut(s) 16, 67, 158, 177, 219, 257, 284, 379
CviKI_1 RGCY 8 cut(s) 16, 67, 158, 177, 219, 257, 284, 379
DdeI CTNAG 1 cut(s) 201
Eco147I AGGCCT 1 cut(s) 379
Eco47I GGWCC 2 cut(s) 95, 347
EcoNI CCTNNNNNAGG 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 95
EcoRII CCWGG 2 cut(s) 34, 130
FaeI CATG 2 cut(s) 198, 237
FaiI YATR 7 cut(s) 12, 23, 74, 196, 222, 235, 326
FaqI GGGAC 1 cut(s) 108
FatI CATG 2 cut(s) 194, 233
FokI GGATG 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 174
HaeIII GGCC 2 cut(s) 219, 379
Hin1II CATG 2 cut(s) 198, 237
HincII GTYRAC 1 cut(s) 295
HindII GTYRAC 1 cut(s) 295
HinfI GANTC 1 cut(s) 335
HpaI GTTAAC 1 cut(s) 295
HphI GGTGA 1 cut(s) 146
Hpy166II GTNNAC 2 cut(s) 43, 295
Hpy188I TCNGA 3 cut(s) 104, 313, 334
Hpy188III TCNNGA 2 cut(s) 44, 117
Hpy8I GTNNAC 2 cut(s) 43, 295
HpyAV CCTTC 1 cut(s) 361
HpyCH4IV ACGT 1 cut(s) 261
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 1 cut(s) 261
Hsp92II CATG 2 cut(s) 198, 237
KspAI GTTAAC 1 cut(s) 295
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 8 cut(s) 21, 30, 48, 111, 117, 138, 144, 162
LweI GCATC 1 cut(s) 346
MabI ACCWGGT 1 cut(s) 130
MaeII ACGT 1 cut(s) 261
MaeIII GTNAC 3 cut(s) 165, 190, 262
MluCI AATT 5 cut(s) 69, 110, 137, 269, 307
MlyI GAGTC 1 cut(s) 329
MnlI CCTC 4 cut(s) 87, 208, 321, 369
MseI TTAA 2 cut(s) 294, 342
MspR9I CCNGG 2 cut(s) 36, 132
MvaI CCWGG 2 cut(s) 36, 132
NlaIII CATG 2 cut(s) 198, 237
NlaIV GGNNCC 2 cut(s) 96, 129
NmuCI GTSAC 1 cut(s) 190
NspI RCATGY 2 cut(s) 198, 237
PaqCI CACCTGC 1 cut(s) 157
PceI AGGCCT 1 cut(s) 379
PciI ACATGT 2 cut(s) 194, 233
PflMI CCANNNNNTGG 1 cut(s) 152
PleI GAGTC 1 cut(s) 329
PpsI GAGTC 1 cut(s) 329
PpuMI RGGWCCY 1 cut(s) 95
PscI ACATGT 2 cut(s) 194, 233
Psp1406I AACGTT 1 cut(s) 261
Psp5II RGGWCCY 1 cut(s) 95
Psp6I CCWGG 2 cut(s) 34, 130
PspGI CCWGG 2 cut(s) 34, 130
PspN4I GGNNCC 2 cut(s) 96, 129
PspPI GGNCC 3 cut(s) 95, 217, 347
PspPPI RGGWCCY 1 cut(s) 95
SaqAI TTAA 2 cut(s) 294, 342
Sau96I GGNCC 3 cut(s) 95, 217, 347
SchI GAGTC 1 cut(s) 329
ScrFI CCNGG 2 cut(s) 36, 132
SexAI ACCWGGT 1 cut(s) 130
SfaNI GCATC 1 cut(s) 346
SinI GGWCC 2 cut(s) 95, 347
Sse9I AATT 5 cut(s) 69, 110, 137, 269, 307
SseBI AGGCCT 1 cut(s) 379
StuI AGGCCT 1 cut(s) 379
StyD4I CCNGG 2 cut(s) 34, 130
TaiI ACGT 1 cut(s) 264
TasI AATT 5 cut(s) 69, 110, 137, 269, 307
Tru1I TTAA 2 cut(s) 294, 342
Tru9I TTAA 2 cut(s) 294, 342
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
Van91I CCANNNNNTGG 1 cut(s) 152
VpaK11BI GGWCC 2 cut(s) 95, 347
XagI CCTNNNNNAGG 1 cut(s) 33
XceI RCATGY 2 cut(s) 198, 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.