Rw0G009300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00363
OG0000691
Physical Location & Seq
Forward (+)
30776 .. 32986
2211 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G009300.1

Sequence Viewer

Length: 480 bp
ATGGAAGCAATGAAAGCAACAATTGAGGAACAACGCTTGGAGACTGCAAGATTGAGGAGTGAAGTAGCCCCACCACCTGGAGCAGAGAAGCTGCCTAATGTCTATTACCAACAGGTCACTTATGGAATATGTAAGAAGAAGGGCCACAACATGAGGACCTGCAAGGTGAGGAATCAGCAAGGTGAGAATGCGCAGCTGCAACAACAACAAGAAGATGAGGCAGTGCAGCAACCAGAAAATGAGGAAGTTTTGCAGCAGGATCCTCAAGAAGCTGACCAAGTGGAGCCACAAGTCTCCAGAATGTGCAAGACTCCCAACAAGCTTATGTCACAACCCAGGAATCACAGATTGCTACTGCTTCAGGCAGCTCCTTCAGAACTGGTTTCACAACCAGAAGGTTCAAAGTGCTTGCTAACAGAAAATCTAGACCAGCAAATCCCCCTCTATCAGCAAACAATGAATCTGAATAGGATGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

18.24

Weight (kDa)

5.5

Isoelectric Point (pI)

68.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 192
Acc36I ACCTGC 1 cut(s) 167
AccB7I CCANNNNNTGG 1 cut(s) 77
AclWI GGATC 2 cut(s) 254, 267
AcuI CTGAAG 2 cut(s) 344, 357
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 402
AjnI CCWGG 2 cut(s) 76, 335
AluBI AGCT 5 cut(s) 91, 196, 272, 322, 368
AluI AGCT 5 cut(s) 91, 196, 272, 322, 368
Alw26I GTCTC 2 cut(s) 35, 298
AlwI GGATC 2 cut(s) 254, 267
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 6 cut(s) 91, 193, 196, 226, 253, 365
AspLEI GCGC 1 cut(s) 193
AspS9I GGNCC 2 cut(s) 142, 156
AsuHPI GGTGA 2 cut(s) 178, 194
AvaII GGWCC 1 cut(s) 156
BamHI GGATCC 1 cut(s) 259
BbvI GCAGC 6 cut(s) 78, 183, 205, 238, 265, 377
BciT130I CCWGG 2 cut(s) 78, 337
BcoDI GTCTC 2 cut(s) 35, 298
BfaI CTAG 1 cut(s) 425
BfuAI ACCTGC 1 cut(s) 167
BisI GCNGC 6 cut(s) 92, 194, 197, 227, 254, 366
BlsI GCNGC 6 cut(s) 93, 195, 198, 228, 255, 367
Bme1390I CCNGG 2 cut(s) 78, 337
Bme18I GGWCC 1 cut(s) 156
BmgT120I GGNCC 2 cut(s) 142, 156
BmiI GGNNCC 2 cut(s) 261, 285
BmrFI CCNGG 2 cut(s) 78, 337
BpmI CTGGAG 2 cut(s) 99, 280
BpuEI CTTGAG 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 335
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse1I ACTGG 1 cut(s) 384
Bse3DI GCAATG 1 cut(s) 15
BseBI CCWGG 2 cut(s) 78, 337
BseDI CCNNGG 1 cut(s) 335
BseGI GGATG 1 cut(s) 477
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMI GCAATG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 384
BseRI GAGGAG 1 cut(s) 70
BseXI GCAGC 6 cut(s) 78, 183, 205, 238, 265, 377
BsgI GTGCAG 1 cut(s) 245
BshFI GGCC 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 2 cut(s) 35, 298
BsmI GAATGC 1 cut(s) 193
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 259
BspANI GGCC 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 261, 285
BspMI ACCTGC 1 cut(s) 167
BspPI GGATC 2 cut(s) 254, 267
BsrDI GCAATG 1 cut(s) 15
BsrI ACTGG 1 cut(s) 384
BssECI CCNNGG 1 cut(s) 335
BssMI GATC 1 cut(s) 259
Bst2UI CCWGG 2 cut(s) 78, 337
BstC8I GCNNGC 1 cut(s) 410
BstF5I GGATG 1 cut(s) 477
BstHHI GCGC 1 cut(s) 193
BstKTI GATC 1 cut(s) 262
BstMAI GTCTC 2 cut(s) 35, 298
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstNI CCWGG 2 cut(s) 78, 337
BstSCI CCNGG 2 cut(s) 76, 335
BstV1I GCAGC 6 cut(s) 78, 183, 205, 238, 265, 377
BstX2I RGATCY 1 cut(s) 259
BstYI RGATCY 1 cut(s) 259
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 1 cut(s) 477
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 1 cut(s) 228
BveI ACCTGC 1 cut(s) 167
Cac8I GCNNGC 1 cut(s) 410
CfoI GCGC 1 cut(s) 193
Cfr13I GGNCC 2 cut(s) 142, 156
CviAII CATG 1 cut(s) 151
CviJI RGCY 8 cut(s) 68, 91, 144, 196, 272, 286, 322, 368
CviKI_1 RGCY 8 cut(s) 68, 91, 144, 196, 272, 286, 322, 368
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eco47I GGWCC 1 cut(s) 156
Eco57I CTGAAG 2 cut(s) 344, 357
EcoO109I RGGNCCY 1 cut(s) 156
EcoRII CCWGG 2 cut(s) 76, 335
FaeI CATG 1 cut(s) 154
FaiI YATR 4 cut(s) 123, 130, 152, 326
FatI CATG 1 cut(s) 150
Fnu4HI GCNGC 6 cut(s) 92, 194, 197, 227, 254, 366
Fsp4HI GCNGC 6 cut(s) 92, 194, 197, 227, 254, 366
FspBI CTAG 1 cut(s) 425
FspI TGCGCA 1 cut(s) 192
GlaI GCGC 1 cut(s) 192
GluI GCNGC 6 cut(s) 92, 194, 197, 227, 254, 366
GsuI CTGGAG 2 cut(s) 99, 280
HaeIII GGCC 1 cut(s) 144
HhaI GCGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 154
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HindIII AAGCTT 1 cut(s) 320
HinfI GANTC 4 cut(s) 172, 310, 340, 460
HphI GGTGA 2 cut(s) 178, 194
Hpy188I TCNGA 2 cut(s) 376, 465
Hpy188III TCNNGA 3 cut(s) 266, 297, 425
HpyAV CCTTC 3 cut(s) 133, 381, 389
HpyCH4V TGCA 6 cut(s) 47, 162, 199, 226, 253, 306
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
Hsp92II CATG 1 cut(s) 154
HspAI GCGC 1 cut(s) 191
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 3 cut(s) 80, 283, 373
Lsp1109I GCAGC 6 cut(s) 78, 183, 205, 238, 265, 377
MaeI CTAG 1 cut(s) 425
MaeIII GTNAC 2 cut(s) 115, 327
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 2 cut(s) 148, 224
MfeI CAATTG 1 cut(s) 21
MflI RGATCY 1 cut(s) 259
MluCI AATT 1 cut(s) 21
MlyI GAGTC 1 cut(s) 304
MnlI CCTC 8 cut(s) 19, 48, 147, 162, 211, 235, 273, 452
MspA1I CMGCKG 1 cut(s) 196
MspR9I CCNGG 2 cut(s) 78, 337
MunI CAATTG 1 cut(s) 21
Mva1269I GAATGC 1 cut(s) 193
MvaI CCWGG 2 cut(s) 78, 337
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeII GATC 1 cut(s) 259
NlaIII CATG 1 cut(s) 154
NlaIV GGNNCC 2 cut(s) 261, 285
NmuCI GTSAC 2 cut(s) 115, 327
NsbI TGCGCA 1 cut(s) 192
PctI GAATGC 1 cut(s) 193
PfeI GAWTC 3 cut(s) 172, 340, 460
PflMI CCANNNNNTGG 1 cut(s) 77
PkrI GCNGC 6 cut(s) 93, 195, 198, 228, 255, 367
PleI GAGTC 1 cut(s) 304
PpsI GAGTC 1 cut(s) 304
PpuMI RGGWCCY 1 cut(s) 156
Psp5II RGGWCCY 1 cut(s) 156
Psp6I CCWGG 2 cut(s) 76, 335
PspGI CCWGG 2 cut(s) 76, 335
PspN4I GGNNCC 2 cut(s) 261, 285
PspPI GGNCC 2 cut(s) 142, 156
PspPPI RGGWCCY 1 cut(s) 156
PsuI RGATCY 1 cut(s) 259
PvuII CAGCTG 1 cut(s) 196
SatI GCNGC 6 cut(s) 92, 194, 197, 227, 254, 366
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 2 cut(s) 142, 156
SchI GAGTC 1 cut(s) 304
ScrFI CCNGG 2 cut(s) 78, 337
SinI GGWCC 1 cut(s) 156
SmlI CTYRAG 1 cut(s) 264
SmoI CTYRAG 1 cut(s) 264
Sse9I AATT 1 cut(s) 21
SspMI CTAG 1 cut(s) 425
StyD4I CCNGG 2 cut(s) 76, 335
TasI AATT 1 cut(s) 21
TfiI GAWTC 3 cut(s) 172, 340, 460
TscAI CASTG 1 cut(s) 228
TseFI GTSAC 2 cut(s) 115, 327
TseI GCWGC 6 cut(s) 91, 193, 196, 226, 253, 365
Tsp45I GTSAC 2 cut(s) 115, 327
TspDTI ATGAA 2 cut(s) 26, 473
TspRI CASTG 1 cut(s) 228
Van91I CCANNNNNTGG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 156
XbaI TCTAGA 1 cut(s) 424
XspI CTAG 1 cut(s) 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.