Rroxscaffold_3G00276270

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
67545148 .. 67548306
3159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00276270.1

Sequence Viewer

Length: 426 bp
ATGCAACCAGCTGCTGGAACAACTAAATTACCCAAGATATATTACAGTAAGATAAGTTGTGGAAAATGTCACAAGCAAGGGCATTACATGAGGACTTGTGATAGGCGCAATCAACAAGGAAGTACCTCTCAAGCTAGTTCTACTATGCAGCAAGGCGATGCAAATGAAAAAGGTTCTCAAAATGTTCAGCAAGATGGCAATGCAAATGATGAACATAGAATGCAGAATCCTCAGCAATGTGGCAATTCTAATGGACATGGTTCTGAAAATGTTCACGATGAGGTAATCATTCATAAAATTAGAATGTCAAAGCTTAAATGTAAAATTAGGTTTTTGGGCCATTGCACGAAATTAAATGGGTCTTTTGTTTTACTCGAAATCATAATATCAAAGCTTAAATGCCAATCATTGATGCTTCTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.76

Weight (kDa)

9.38

Isoelectric Point (pI)

44.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 14
AfaI GTAC 1 cut(s) 124
AfiI CCNNNNNNNGG 1 cut(s) 14
AluBI AGCT 4 cut(s) 11, 134, 313, 394
AluI AGCT 4 cut(s) 11, 134, 313, 394
AlwNI CAGNNNCTG 1 cut(s) 14
AoxI GGCC 1 cut(s) 337
ApeKI GCWGC 2 cut(s) 11, 148
Asp700I GAANNNNTTC 1 cut(s) 270
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 337
BbvCI CCTCAGC 1 cut(s) 231
BbvI GCAGC 1 cut(s) 160
BccI CCATC 1 cut(s) 188
BfaI CTAG 1 cut(s) 135
BisI GCNGC 2 cut(s) 12, 149
BlsI GCNGC 2 cut(s) 13, 150
BmgT120I GGNCC 1 cut(s) 337
BmsI GCATC 2 cut(s) 148, 402
Bpu10I CCTNAGC 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 114
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse3DI GCAATG 3 cut(s) 205, 242, 340
BseLI CCNNNNNNNGG 1 cut(s) 14
BseMI GCAATG 3 cut(s) 205, 242, 340
BseMII CTCAG 1 cut(s) 245
BseXI GCAGC 1 cut(s) 160
BshFI GGCC 1 cut(s) 339
BslI CCNNNNNNNGG 1 cut(s) 14
BsmI GAATGC 1 cut(s) 225
BsnI GGCC 1 cut(s) 339
BspANI GGCC 1 cut(s) 339
BspCNI CTCAG 1 cut(s) 244
BsrDI GCAATG 3 cut(s) 205, 242, 340
Bst4CI ACNGT 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 231
BstHHI GCGC 1 cut(s) 108
BstV1I GCAGC 1 cut(s) 160
BsuRI GGCC 1 cut(s) 339
BtgZI GCGATG 1 cut(s) 171
CaiI CAGNNNCTG 1 cut(s) 14
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 337
Csp6I GTAC 1 cut(s) 123
CviAII CATG 2 cut(s) 88, 257
CviJI RGCY 5 cut(s) 11, 134, 313, 339, 394
CviKI_1 RGCY 5 cut(s) 11, 134, 313, 339, 394
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 1 cut(s) 231
FaeI CATG 2 cut(s) 91, 260
FaiI YATR 7 cut(s) 40, 89, 146, 216, 258, 294, 383
FatI CATG 2 cut(s) 87, 256
Fnu4HI GCNGC 2 cut(s) 12, 149
Fsp4HI GCNGC 2 cut(s) 12, 149
FspBI CTAG 1 cut(s) 135
GlaI GCGC 1 cut(s) 107
GluI GCNGC 2 cut(s) 12, 149
HaeIII GGCC 1 cut(s) 339
HhaI GCGC 1 cut(s) 108
Hin1II CATG 2 cut(s) 91, 260
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HindIII AAGCTT 2 cut(s) 311, 392
HinfI GANTC 1 cut(s) 226
Hpy166II GTNNAC 1 cut(s) 274
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 1 cut(s) 275
Hpy8I GTNNAC 1 cut(s) 274
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 6 cut(s) 4, 148, 161, 203, 223, 345
HpyF3I CTNAG 1 cut(s) 231
Hsp92II CATG 2 cut(s) 91, 260
HspAI GCGC 1 cut(s) 106
LpnPI CCDG 1 cut(s) 21
Lsp1109I GCAGC 1 cut(s) 160
LweI GCATC 2 cut(s) 148, 402
MaeI CTAG 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 68
MluCI AATT 5 cut(s) 26, 244, 297, 324, 350
MnlI CCTC 4 cut(s) 84, 136, 240, 274
MroXI GAANNNNTTC 1 cut(s) 270
MseI TTAA 3 cut(s) 315, 353, 396
MspA1I CMGCKG 1 cut(s) 11
Mva1269I GAATGC 1 cut(s) 225
NlaIII CATG 2 cut(s) 91, 260
NmuCI GTSAC 1 cut(s) 68
PctI GAATGC 1 cut(s) 225
PdmI GAANNNNTTC 1 cut(s) 270
PfeI GAWTC 1 cut(s) 226
PflMI CCANNNNNTGG 1 cut(s) 14
PkrI GCNGC 2 cut(s) 13, 150
PspPI GGNCC 1 cut(s) 337
PstNI CAGNNNCTG 1 cut(s) 14
PvuII CAGCTG 1 cut(s) 11
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SaqAI TTAA 3 cut(s) 315, 353, 396
SatI GCNGC 2 cut(s) 12, 149
Sau96I GGNCC 1 cut(s) 337
SetI ASST 8 cut(s) 13, 128, 136, 175, 285, 315, 332, 396
SfaNI GCATC 2 cut(s) 148, 402
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 5 cut(s) 26, 244, 297, 324, 350
SspMI CTAG 1 cut(s) 135
TaaI ACNGT 1 cut(s) 47
TaqI TCGA 1 cut(s) 375
TasI AATT 5 cut(s) 26, 244, 297, 324, 350
TfiI GAWTC 1 cut(s) 226
Tru1I TTAA 3 cut(s) 315, 353, 396
Tru9I TTAA 3 cut(s) 315, 353, 396
TseFI GTSAC 1 cut(s) 68
TseI GCWGC 2 cut(s) 11, 148
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 3 cut(s) 180, 225, 281
Van91I CCANNNNNTGG 1 cut(s) 14
XmnI GAANNNNTTC 1 cut(s) 270
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.