MD17G1070900.v1.1

phenolic glucoside malonyltransferase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
5727198 .. 5729568
2371 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1070900.v1.1.491

Sequence Viewer

Length: 195 bp
ATGTTGAAGTTAGTGGCTGATTTCGGTTGGGGAAGACTGACGAAGCACGAGATAGTTTCGATAGATGGGACAGGAGCGATACCTTTTCAAGCGAGCAAGAATGGTGATGGTGGTGTTAAGGTTGGCTTGGTTTTGGAAAAACATTGTATGGAGGCTTTTGGTTCTCTATTTGCTAATCGTCTTGAAGACATTTGA

Protein Analysis

65

Amino Acids

6.89

Weight (kDa)

6.02

Isoelectric Point (pI)

9.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000138)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G29590 AT3G29635 AT3G29636 AT3G29670 AT3G29680 AT3G29690 AT3G29720 AT5G39050 AT5G39080 AT5G39090 AT5G61160
fragaria_vesca FvH4_6g46740 FvH4_6g46741 FvH4_6g46742 FvH4_6g46743 FvH4_6g46743 FvH4_6g46750 FvH4_6g46770 FvH4_6g46780 FvH4_6g48750 FvH4_6g48770 FvH4_7g01310 FvH4_7g01410
malus_domestica MD09G1060700.v1.1 MD09G1067500.v1.1 MD09G1067900.v1.1 MD09G1068000.v1.1 MD09G1068100.v1.1 MD09G1080400.v1.1 MD09G1080500.v1.1 MD17G1056000.v1.1 MD17G1056100.v1.1 MD17G1060500.v1.1 MD17G1060600.v1.1 MD17G1060700.v1.1 MD17G1060800.v1.1 MD17G1061000.v1.1 MD17G1070900.v1.1 MD17G1071300.v1.1 MD17G1071400.v1.1
prunus_persica Prupe.3G252700_v2.0.a1 Prupe.3G252800_v2.0.a1 Prupe.3G252900_v2.0.a1 Prupe.3G253000_v2.0.a1 Prupe.3G253100_v2.0.a1 Prupe.3G253200_v2.0.a1 Prupe.3G253300_v2.0.a1 Prupe.3G253400_v2.0.a1 Prupe.3G253500_v2.0.a1 Prupe.3G253600_v2.0.a1 Prupe.3G253700_v2.0.a1 Prupe.3G253800_v2.0.a1 Prupe.3G253900_v2.0.a1 Prupe.3G254000_v2.0.a1 Prupe.3G254200_v2.0.a1 Prupe.3G254300_v2.0.a1 Prupe.3G254400_v2.0.a1
pyrus_communis pycom09g00710 pycom111g05670 pycom111g05680 pycom111g05700 pycom111g05710 pycom111g05720 pycom12433g00160 pycom17g05440 pycom17g05520 pycom17g06020 pycom17g06030 pycom17g06040 pycom17g06050 pycom17g06060 pycom17g07080
rosa_chinensis RchiOBHm_Chr1g0317141 RchiOBHm_Chr1g0317151 RchiOBHm_Chr1g0317191 RchiOBHm_Chr1g0317201 RchiOBHm_Chr1g0317211 RchiOBHm_Chr1g0334681 RchiOBHm_Chr1g0334691 RchiOBHm_Chr2g0165681 RchiOBHm_Chr2g0165721 RchiOBHm_Chr2g0165731 RchiOBHm_Chr2g0165741 RchiOBHm_Chr2g0165751 RchiOBHm_Chr2g0165771 RchiOBHm_Chr2g0165781 RchiOBHm_Chr5g0029321 RchiOBHm_Chr5g0029331
rosa_laevigata RLG00000021545 RLG00000021546 RLG00000021548 RLG00000021549 RLG00000021550 RLG00000021551 RLG00000021552 RLG00000029433 RLG00000029434 RLG00000029435 RLG00000029439 RLG00000029441 RLG00000029442 RLG00000030618 RLG00000030619 RLG00000030620 RLG00000030622 RLG00000033153 RLG00000033154 RLG00000033155 RLG00000033156
rosa_multiflora Rmu_co7981466.1_g000001 Rmu_co8034280.1_g000001 Rmu_co8243107.1_g000001 Rmu_co8406929.1_g000001 Rmu_sc0000802.1_g000001 Rmu_sc0002295.1_g000005 Rmu_sc0003227.1_g000026 Rmu_sc0003227.1_g000028 Rmu_sc0003227.1_g000029 Rmu_sc0003227.1_g000030 Rmu_sc0003227.1_g000031 Rmu_sc0003689.1_g000001 Rmu_sc0003689.1_g000007 Rmu_sc0004137.1_g000001 Rmu_sc0004205.1_g000004 Rmu_sc0006595.1_g000001 Rmu_sc0006595.1_g000002 Rmu_sc0006595.1_g000003 Rmu_sc0006595.1_g000005 Rmu_sc0009268.1_g000003 Rmu_sc0009268.1_g000004 Rmu_sc0009268.1_g000005 Rmu_sc0009268.1_g000012 Rmu_sc0010198.1_g000001 Rmu_sc0010198.1_g000003 Rmu_sc0010463.1_g000008 Rmu_sc0011453.1_g000001 Rmu_sc0013848.1_g000001 Rmu_sc0013964.1_g000002 Rmu_sc0020734.1_g000001 Rmu_sc0021275.1_g000001 Rmu_sc0024807.1_g000001
rosa_roxburghii Rroxscaffold_1G00039060 Rroxscaffold_2G00085550 Rroxscaffold_2G00085570 Rroxscaffold_2G00085590 Rroxscaffold_2G00085600 Rroxscaffold_2G00085630 Rroxscaffold_2G00085660 Rroxscaffold_2G00085670 Rroxscaffold_4G00316670 Rroxscaffold_4G00316720 Rroxscaffold_4G00316730 Rroxscaffold_4G00330570 Rroxscaffold_4G00330590 Rroxscaffold_4G00330600 Rroxscaffold_4G00330620
rosa_rugosa Rorug01G0014900 Rorug01G0015000 Rorug01G0015200 Rorug01G0114800 Rorug01G0114800 Rorug02G0516600 Rorug02G0516700 Rorug02G0516800 Rorug02G0516900 Rorug02G0517000 Rorug02G0517100 Rorug02G0517200 Rorug02G0517300 Rorug05G0113300
rosa_samantha Rh1BG022500 Rh1BG022600 Rh1BG106200 Rh1BG106400 Rh1BG106500 Rh2AG557600 Rh2CG564900 Rh2CG565000 Rh2CG565100 Rh2CG565200 Rh2CG565400 Rh2CG565500 Rh2CG565600 Rh2CG565700 Rh5CG225500 Rh5CG225600
rosa_wichuraiana Rw0G011340 Rw0G011350 Rw0G011360 Rw0G016000 Rw0G016010 Rw0G016020 Rw0G016030 Rw1G001820 Rw1G001830 Rw1G011540 Rw1G011550 Rw2G048610 Rw2G048620 Rw2G048630 Rw5G018670 Rw5G018680 Rw5G018690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 7, 89, 185
AsuHPI GGTGA 1 cut(s) 116
BauI CACGAG 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 40
BccI CCATC 2 cut(s) 59, 101
BpiI GAAGAC 1 cut(s) 40
BslFI GGGAC 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 82
BssSI CACGAG 1 cut(s) 47
Bst2BI CACGAG 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 94
CviJI RGCY 3 cut(s) 17, 126, 155
CviKI_1 RGCY 3 cut(s) 17, 126, 155
FaiI YATR 1 cut(s) 149
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FaqI GGGAC 1 cut(s) 82
HphI GGTGA 1 cut(s) 116
Hpy188III TCNNGA 1 cut(s) 182
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 1 cut(s) 57
MboII GAAGA 1 cut(s) 45
MnlI CCTC 1 cut(s) 145
MseI TTAA 1 cut(s) 117
SaqAI TTAA 1 cut(s) 117
SetI ASST 2 cut(s) 85, 123
SgeI CNNG 7 cut(s) 59, 61, 84, 101, 105, 109, 139
TaqI TCGA 1 cut(s) 59
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.