Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr17

Orthogroup ID

OG0000138

Physical Location & Seq

Genomic Coordinates Reverse (-)

5727198 .. 5729568

Gene Structure 2371 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD17G1070900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 195 bp

ATGTTGAAGTTAGTGGCTGATTTCGGTTGGGGAAGACTGACGAAGCACGAGATAGTTTCGATAGATGGGACAGGAGCGATACCTTTTCAAGCGAGCAAGAATGGTGATGGTGGTGTTAAGGTTGGCTTGGTTTTGGAAAAACATTGTATGGAGGCTTTTGGTTCTCTATTTGCTAATCGTCTTGAAGACATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0008150 GO:0008152 GO:0008374 GO:0009058 GO:0009718 GO:0009812 GO:0009813 GO:0016420 GO:0016740 GO:0016746 GO:0016747 GO:0042440 GO:0044424 GO:0044444 GO:0044464 GO:0046148 GO:0046283 GO:0047634 GO:0050736 GO:0071704 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00330 ko00943 ko00944 map00330 map00943 map00944

Pfam Domains

Protein Families

Transferase

Protein Analysis

65

Amino Acids

6.89

Weight (kDa)

6.02

Isoelectric Point (pI)

9.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000138)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G29590 AT3G29635 AT3G29636 AT3G29670 AT3G29680 AT3G29690 AT3G29720 AT5G39050 AT5G39080 AT5G39090 AT5G61160
fragaria_vesca	FvH4_6g46740 FvH4_6g46741 FvH4_6g46742 FvH4_6g46743 FvH4_6g46743 FvH4_6g46750 FvH4_6g46770 FvH4_6g46780 FvH4_6g48750 FvH4_6g48770 FvH4_7g01310 FvH4_7g01410
malus_domestica	MD09G1060700.v1.1 MD09G1067500.v1.1 MD09G1067900.v1.1 MD09G1068000.v1.1 MD09G1068100.v1.1 MD09G1080400.v1.1 MD09G1080500.v1.1 MD17G1056000.v1.1 MD17G1056100.v1.1 MD17G1060500.v1.1 MD17G1060600.v1.1 MD17G1060700.v1.1 MD17G1060800.v1.1 MD17G1061000.v1.1 MD17G1070900.v1.1 MD17G1071300.v1.1 MD17G1071400.v1.1
prunus_persica	Prupe.3G252700_v2.0.a1 Prupe.3G252800_v2.0.a1 Prupe.3G252900_v2.0.a1 Prupe.3G253000_v2.0.a1 Prupe.3G253100_v2.0.a1 Prupe.3G253200_v2.0.a1 Prupe.3G253300_v2.0.a1 Prupe.3G253400_v2.0.a1 Prupe.3G253500_v2.0.a1 Prupe.3G253600_v2.0.a1 Prupe.3G253700_v2.0.a1 Prupe.3G253800_v2.0.a1 Prupe.3G253900_v2.0.a1 Prupe.3G254000_v2.0.a1 Prupe.3G254200_v2.0.a1 Prupe.3G254300_v2.0.a1 Prupe.3G254400_v2.0.a1
pyrus_communis	pycom09g00710 pycom111g05670 pycom111g05680 pycom111g05700 pycom111g05710 pycom111g05720 pycom12433g00160 pycom17g05440 pycom17g05520 pycom17g06020 pycom17g06030 pycom17g06040 pycom17g06050 pycom17g06060 pycom17g07080
rosa_chinensis	RchiOBHm_Chr1g0317141 RchiOBHm_Chr1g0317151 RchiOBHm_Chr1g0317191 RchiOBHm_Chr1g0317201 RchiOBHm_Chr1g0317211 RchiOBHm_Chr1g0334681 RchiOBHm_Chr1g0334691 RchiOBHm_Chr2g0165681 RchiOBHm_Chr2g0165721 RchiOBHm_Chr2g0165731 RchiOBHm_Chr2g0165741 RchiOBHm_Chr2g0165751 RchiOBHm_Chr2g0165771 RchiOBHm_Chr2g0165781 RchiOBHm_Chr5g0029321 RchiOBHm_Chr5g0029331
rosa_laevigata	RLG00000021545 RLG00000021546 RLG00000021548 RLG00000021549 RLG00000021550 RLG00000021551 RLG00000021552 RLG00000029433 RLG00000029434 RLG00000029435 RLG00000029439 RLG00000029441 RLG00000029442 RLG00000030618 RLG00000030619 RLG00000030620 RLG00000030622 RLG00000033153 RLG00000033154 RLG00000033155 RLG00000033156
rosa_multiflora	Rmu_co7981466.1_g000001 Rmu_co8034280.1_g000001 Rmu_co8243107.1_g000001 Rmu_co8406929.1_g000001 Rmu_sc0000802.1_g000001 Rmu_sc0002295.1_g000005 Rmu_sc0003227.1_g000026 Rmu_sc0003227.1_g000028 Rmu_sc0003227.1_g000029 Rmu_sc0003227.1_g000030 Rmu_sc0003227.1_g000031 Rmu_sc0003689.1_g000001 Rmu_sc0003689.1_g000007 Rmu_sc0004137.1_g000001 Rmu_sc0004205.1_g000004 Rmu_sc0006595.1_g000001 Rmu_sc0006595.1_g000002 Rmu_sc0006595.1_g000003 Rmu_sc0006595.1_g000005 Rmu_sc0009268.1_g000003 Rmu_sc0009268.1_g000004 Rmu_sc0009268.1_g000005 Rmu_sc0009268.1_g000012 Rmu_sc0010198.1_g000001 Rmu_sc0010198.1_g000003 Rmu_sc0010463.1_g000008 Rmu_sc0011453.1_g000001 Rmu_sc0013848.1_g000001 Rmu_sc0013964.1_g000002 Rmu_sc0020734.1_g000001 Rmu_sc0021275.1_g000001 Rmu_sc0024807.1_g000001
rosa_roxburghii	Rroxscaffold_1G00039060 Rroxscaffold_2G00085550 Rroxscaffold_2G00085570 Rroxscaffold_2G00085590 Rroxscaffold_2G00085600 Rroxscaffold_2G00085630 Rroxscaffold_2G00085660 Rroxscaffold_2G00085670 Rroxscaffold_4G00316670 Rroxscaffold_4G00316720 Rroxscaffold_4G00316730 Rroxscaffold_4G00330570 Rroxscaffold_4G00330590 Rroxscaffold_4G00330600 Rroxscaffold_4G00330620
rosa_rugosa	Rorug01G0014900 Rorug01G0015000 Rorug01G0015200 Rorug01G0114800 Rorug01G0114800 Rorug02G0516600 Rorug02G0516700 Rorug02G0516800 Rorug02G0516900 Rorug02G0517000 Rorug02G0517100 Rorug02G0517200 Rorug02G0517300 Rorug05G0113300
rosa_samantha	Rh1BG022500 Rh1BG022600 Rh1BG106200 Rh1BG106400 Rh1BG106500 Rh2AG557600 Rh2CG564900 Rh2CG565000 Rh2CG565100 Rh2CG565200 Rh2CG565400 Rh2CG565500 Rh2CG565600 Rh2CG565700 Rh5CG225500 Rh5CG225600
rosa_wichuraiana	Rw0G011340 Rw0G011350 Rw0G011360 Rw0G016000 Rw0G016010 Rw0G016020 Rw0G016030 Rw1G001820 Rw1G001830 Rw1G011540 Rw1G011550 Rw2G048610 Rw2G048620 Rw2G048630 Rw5G018670 Rw5G018680 Rw5G018690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	3 cut(s)	7, 89, 185
AsuHPI	GGTGA	1 cut(s)	116
BauI	CACGAG	1 cut(s)	47
BbsI	GAAGAC	1 cut(s)	40
BccI	CCATC	2 cut(s)	59, 101
BpiI	GAAGAC	1 cut(s)	40
BslFI	GGGAC	1 cut(s)	82
BsmFI	GGGAC	1 cut(s)	82
BssSI	CACGAG	1 cut(s)	47
Bst2BI	CACGAG	1 cut(s)	47
BstC8I	GCNNGC	1 cut(s)	94
BstV2I	GAAGAC	1 cut(s)	40
Cac8I	GCNNGC	1 cut(s)	94
CviJI	RGCY	3 cut(s)	17, 126, 155
CviKI_1	RGCY	3 cut(s)	17, 126, 155
FaiI	YATR	1 cut(s)	149
FalI	AAGNNNNNCTT	2 cut(s)	110, 142
FaqI	GGGAC	1 cut(s)	82
HphI	GGTGA	1 cut(s)	116
Hpy188III	TCNNGA	1 cut(s)	182
LmnI	GCTCC	1 cut(s)	74
LpnPI	CCDG	1 cut(s)	57
MboII	GAAGA	1 cut(s)	45
MnlI	CCTC	1 cut(s)	145
MseI	TTAA	1 cut(s)	117
SaqAI	TTAA	1 cut(s)	117
SetI	ASST	2 cut(s)	85, 123
SgeI	CNNG	7 cut(s)	59, 61, 84, 101, 105, 109, 139
TaqI	TCGA	1 cut(s)	59
Tru1I	TTAA	1 cut(s)	117
Tru9I	TTAA	1 cut(s)	117

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.