Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0000782

Physical Location & Seq

Genomic Coordinates Reverse (-)

65475125 .. 65477434

Gene Structure 2310 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ51743

Sequence Viewer

CDS Protein Promoter (2k)

Length: 147 bp

ATGCAAAGGAGTATTTGGGTTGTTCTTTTGCCAGTGTTCCTGGTTTGGTTAGTTGGTGTTACTTGGTTGTGCTGCTGTGAATCAGAGAGCGAGACAGAGAGATGTGCTACTAATGTAGAAGTGAATTATATGCTCAGGCATTTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

48

Amino Acids

5.69

Weight (kDa)

5.01

Isoelectric Point (pI)

54.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000782)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0320691 RchiOBHm_Chr1g0331401 RchiOBHm_Chr1g0334941 RchiOBHm_Chr2g0125261 RchiOBHm_Chr2g0147851 RchiOBHm_Chr4g0395441 RchiOBHm_Chr4g0413151 RchiOBHm_Chr5g0050891 RchiOBHm_Chr6g0258091 RchiOBHm_Chr7g0215701 RchiOBHm_Chr7g0221561 RchiOBHm_Chr7g0229561
rosa_laevigata	RLG00000017433 RLG00000022540 RLG00000029090 RLG00000029561
rosa_multiflora	Rmu_sc0001128.1_g000001 Rmu_sc0004686.1_g000001 Rmu_sc0004964.1_g000001 Rmu_sc0007623.1_g000010 Rmu_sc0008563.1_g000004 Rmu_sc0012350.1_g000001 Rmu_ssc0000111.1_g000017
rosa_roxburghii	Rroxscaffold_2G00077840 Rroxscaffold_2G00106100 Rroxscaffold_2G00131010 Rroxscaffold_3G00249900 Rroxscaffold_4G00279680 Rroxscaffold_4G00300030 Rroxscaffold_4G00316540 Rroxscaffold_5G00334920 Rroxscaffold_5G00337360
rosa_rugosa	Rorug01G0002700 Rorug01G0152900.1 Rorug02G0186900 Rorug04G0107700 Rorug07G0190200 Rorug07G0190200 Rorug07G0248700
rosa_samantha	Rh1AG192200 Rh1AG255100 Rh1BG112800 Rh1CG177400 Rh1DG097600 Rh2AG581700 Rh2CG409700 Rh2DG020900 Rh3BG369400 Rh3DG287800 Rh4CG033700 Rh4DG240100 Rh5AG170700 Rh5AG290100 Rh5BG226500 Rh5CG231500 Rh5DG288600 Rh6AG146100 Rh6BG137300 Rh6CG132600 Rh6CG132700 Rh6CG135200 Rh6DG120100 Rh6DG121800 Rh7AG302500 Rh7DG297300 Rh7DG364300 Rh7DG406700
rosa_wichuraiana	Rw1G008610 Rw2G014670 Rw5G012360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AjnI	CCWGG	1 cut(s)	39
Alw26I	GTCTC	1 cut(s)	86
ApeKI	GCWGC	1 cut(s)	72
BbvI	GCAGC	1 cut(s)	59
BciT130I	CCWGG	1 cut(s)	41
BcoDI	GTCTC	1 cut(s)	86
BisI	GCNGC	1 cut(s)	73
BlsI	GCNGC	1 cut(s)	74
Bme1390I	CCNGG	1 cut(s)	41
BmrFI	CCNGG	1 cut(s)	41
Bpu10I	CCTNAGC	1 cut(s)	134
Bse1I	ACTGG	1 cut(s)	32
BseBI	CCWGG	1 cut(s)	41
BseNI	ACTGG	1 cut(s)	32
BseXI	GCAGC	1 cut(s)	59
BsmAI	GTCTC	1 cut(s)	86
BspCNI	CTCAG	1 cut(s)	147
BsrI	ACTGG	1 cut(s)	32
Bst2UI	CCWGG	1 cut(s)	41
BstDEI	CTNAG	1 cut(s)	134
BstMAI	GTCTC	1 cut(s)	86
BstNI	CCWGG	1 cut(s)	41
BstSCI	CCNGG	1 cut(s)	39
BstV1I	GCAGC	1 cut(s)	59
BtsIMutI	CAGTG	1 cut(s)	39
DdeI	CTNAG	1 cut(s)	134
EcoRII	CCWGG	1 cut(s)	39
FaiI	YATR	2 cut(s)	129, 131
Fnu4HI	GCNGC	1 cut(s)	73
Fsp4HI	GCNGC	1 cut(s)	73
FspEI	CC	8 cut(s)	2, 26, 31, 39, 45, 49, 53, 121
GluI	GCNGC	1 cut(s)	73
HinfI	GANTC	1 cut(s)	80
Hpy188I	TCNGA	1 cut(s)	85
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	1 cut(s)	134
LpnPI	CCDG	4 cut(s)	26, 45, 53, 121
Lsp1109I	GCAGC	1 cut(s)	59
MaeIII	GTNAC	1 cut(s)	58
MluCI	AATT	1 cut(s)	124
MseI	TTAA	1 cut(s)	145
MspR9I	CCNGG	1 cut(s)	41
MvaI	CCWGG	1 cut(s)	41
PfeI	GAWTC	1 cut(s)	80
PkrI	GCNGC	1 cut(s)	74
Psp6I	CCWGG	1 cut(s)	39
PspGI	CCWGG	1 cut(s)	39
SaqAI	TTAA	1 cut(s)	145
SatI	GCNGC	1 cut(s)	73
ScrFI	CCNGG	1 cut(s)	41
SgeI	CNNG	5 cut(s)	44, 52, 53, 75, 103
Sse9I	AATT	1 cut(s)	124
StyD4I	CCNGG	1 cut(s)	39
TasI	AATT	1 cut(s)	124
TfiI	GAWTC	1 cut(s)	80
Tru1I	TTAA	1 cut(s)	145
Tru9I	TTAA	1 cut(s)	145
TscAI	CASTG	1 cut(s)	39
TseI	GCWGC	1 cut(s)	72
TspRI	CASTG	1 cut(s)	39

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.