Rh2CG409700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0000782
Physical Location & Seq
Reverse (-)
55757754 .. 55768508
10755 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG409700.1

Sequence Viewer

Length: 357 bp
ATGGTTGCCTATTTTGATGCTATAACTTTTCTCGTTGATATTGTGATGGCGTCAGAAACTATGATGAGGGGAAGAAAAAGATTATTAATACAGTGTGCTGCTGGAAGTAATGAAAGTAAAGACACAATTGAGCAAAGGAGAACTAAACGTAATCGTGTTTTTTTTGGTGGAGATGAATATGATCGAATTAACTCAGAGAAATGGAAAACGATGTTTGATCCTCAAATTGCTGAAGCATCAAATGTATGTAAGAATGTCACTGGAATTGAACATTTTGACAAACAATGTAGAGCTGACGACCAAAATGTTGGTGCAACTCTAAATGAAGATCCATTTATGGGTCTAGAAGCTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.42

Weight (kDa)

5.17

Isoelectric Point (pI)

37.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 212, 323
AcuI CTGAAG 1 cut(s) 252
AcyI GRCGYC 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 338
AgsI TTSAA 1 cut(s) 269
AluBI AGCT 2 cut(s) 293, 350
AluI AGCT 2 cut(s) 293, 350
AlwI GGATC 2 cut(s) 212, 323
ApeKI GCWGC 2 cut(s) 98, 350
AseI ATTAAT 1 cut(s) 86
BbvI GCAGC 2 cut(s) 85, 337
BccI CCATC 1 cut(s) 40
BfaI CTAG 1 cut(s) 344
BisI GCNGC 2 cut(s) 99, 351
BlsI GCNGC 2 cut(s) 100, 352
BmsI GCATC 2 cut(s) 7, 245
BsaHI GRCGYC 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 338
Bse1I ACTGG 1 cut(s) 265
BseLI CCNNNNNNNGG 1 cut(s) 338
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 265
BseXI GCAGC 2 cut(s) 85, 337
BslI CCNNNNNNNGG 1 cut(s) 338
Bsp143I GATC 3 cut(s) 181, 217, 328
BspCNI CTCAG 1 cut(s) 206
BspPI GGATC 2 cut(s) 212, 323
BsrI ACTGG 1 cut(s) 265
BssMI GATC 3 cut(s) 181, 217, 328
BssNI GRCGYC 1 cut(s) 50
Bst4CI ACNGT 1 cut(s) 93
BstACI GRCGYC 1 cut(s) 50
BstDEI CTNAG 2 cut(s) 193, 354
BstKTI GATC 3 cut(s) 184, 220, 331
BstMBI GATC 3 cut(s) 181, 217, 328
BstV1I GCAGC 2 cut(s) 85, 337
BstX2I RGATCY 1 cut(s) 328
BstXI CCANNNNNNTGG 1 cut(s) 308
BstYI RGATCY 1 cut(s) 328
BtsIMutI CAGTG 2 cut(s) 98, 258
CseI GACGC 1 cut(s) 39
CviJI RGCY 2 cut(s) 293, 350
CviKI_1 RGCY 2 cut(s) 293, 350
DdeI CTNAG 2 cut(s) 193, 354
DpnI GATC 3 cut(s) 183, 219, 330
DpnII GATC 3 cut(s) 181, 217, 328
Eco57I CTGAAG 1 cut(s) 252
FaiI YATR 5 cut(s) 23, 62, 180, 247, 338
Fnu4HI GCNGC 2 cut(s) 99, 351
Fsp4HI GCNGC 2 cut(s) 99, 351
FspBI CTAG 1 cut(s) 344
GluI GCNGC 2 cut(s) 99, 351
HgaI GACGC 1 cut(s) 39
Hin1I GRCGYC 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 55, 196
Hpy188III TCNNGA 1 cut(s) 344
HpyCH4III ACNGT 1 cut(s) 93
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 314
HpyF3I CTNAG 2 cut(s) 193, 354
HpySE526I ACGT 1 cut(s) 148
Hsp92I GRCGYC 1 cut(s) 50
Kzo9I GATC 3 cut(s) 181, 217, 328
LpnPI CCDG 2 cut(s) 87, 246
Lsp1109I GCAGC 2 cut(s) 85, 337
LweI GCATC 2 cut(s) 7, 245
MaeI CTAG 1 cut(s) 344
MaeII ACGT 1 cut(s) 148
MaeIII GTNAC 1 cut(s) 256
MalI GATC 3 cut(s) 183, 219, 330
MboI GATC 3 cut(s) 181, 217, 328
MboII GAAGA 2 cut(s) 84, 338
MfeI CAATTG 1 cut(s) 126
MflI RGATCY 1 cut(s) 328
MluCI AATT 4 cut(s) 126, 186, 225, 264
MnlI CCTC 2 cut(s) 60, 231
MseI TTAA 2 cut(s) 86, 189
MunI CAATTG 1 cut(s) 126
NdeII GATC 3 cut(s) 181, 217, 328
NmuCI GTSAC 1 cut(s) 256
PkrI GCNGC 2 cut(s) 100, 352
PshBI ATTAAT 1 cut(s) 86
PsuI RGATCY 1 cut(s) 328
SaqAI TTAA 2 cut(s) 86, 189
SatI GCNGC 2 cut(s) 99, 351
Sau3AI GATC 3 cut(s) 181, 217, 328
SetI ASST 3 cut(s) 151, 295, 352
SfaNI GCATC 2 cut(s) 7, 245
SgeI CNNG 4 cut(s) 44, 114, 167, 273
Sse9I AATT 4 cut(s) 126, 186, 225, 264
SspMI CTAG 1 cut(s) 344
TaaI ACNGT 1 cut(s) 93
TaiI ACGT 1 cut(s) 151
TaqI TCGA 1 cut(s) 184
TasI AATT 4 cut(s) 126, 186, 225, 264
Tru1I TTAA 2 cut(s) 86, 189
Tru9I TTAA 2 cut(s) 86, 189
TscAI CASTG 2 cut(s) 98, 265
TseFI GTSAC 1 cut(s) 256
TseI GCWGC 2 cut(s) 98, 350
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 3 cut(s) 126, 189, 339
TspRI CASTG 2 cut(s) 98, 265
VspI ATTAAT 1 cut(s) 86
XbaI TCTAGA 1 cut(s) 343
XspI CTAG 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.