Rh1AG192200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
36673735 .. 36677471
3737 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG192200.1

Sequence Viewer

Length: 438 bp
ATGGAAGATAAGAGTGTGAGGAGAGGACTGAAGAGATTATTAGAGCAGTGTGCTGCTGAAAGAAGTGGATCTGATCGTGTTAACTCTAAGAGGTTTAGAACAATGTTGCATCCACACATTGCTGATCCATCAAATCAACCTCAGAATCTAGATGCATTTGAACATAGTGAGGATCAAGGAAGAAGTGAATCTAATCCTGTTAAATCTAAGAGGTGGAGAACAATGTTTCATTCAGATATTTCTGAAGCATCAAGTGAATGCGAGAATGTCGTTATTGAGGATACAGAGGTGGTACCAAAGAGTATGATGAGGAGAATGAACAAATTATTACGCCAGTGTCGTGCTGAAAATCACAAAATTGGAGAGGCAACTGAGCAAGGAAGAATTGAATCTAATCGTATGTGCTCTCCATCATTGATTTATATTCATGTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.75

Weight (kDa)

8.42

Isoelectric Point (pI)

74.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 292
AccB1I GGYRCC 1 cut(s) 292
AclWI GGATC 3 cut(s) 76, 119, 180
AcuI CTGAAG 2 cut(s) 50, 264
AfaI GTAC 1 cut(s) 294
AgsI TTSAA 2 cut(s) 161, 389
Alw21I GWGCWC 1 cut(s) 407
AlwI GGATC 3 cut(s) 76, 119, 180
ApeKI GCWGC 1 cut(s) 53
Asp718I GGTACC 1 cut(s) 292
BaeI ACNNNNGTAYC 2 cut(s) 273, 306
BanI GGYRCC 1 cut(s) 292
Bbv12I GWGCWC 1 cut(s) 407
BbvI GCAGC 1 cut(s) 40
BccI CCATC 2 cut(s) 136, 418
BciVI GTATCC 1 cut(s) 274
BfaI CTAG 1 cut(s) 149
BfuI GTATCC 1 cut(s) 274
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmiI GGNNCC 1 cut(s) 294
BmsI GCATC 3 cut(s) 118, 142, 257
Bse1I ACTGG 1 cut(s) 334
Bse3DI GCAATG 1 cut(s) 117
BseGI GGATG 1 cut(s) 109
BseMI GCAATG 1 cut(s) 117
BseMII CTCAG 2 cut(s) 155, 363
BseNI ACTGG 1 cut(s) 334
BseRI GAGGAG 2 cut(s) 34, 325
BseXI GCAGC 1 cut(s) 40
BshNI GGYRCC 1 cut(s) 292
BsiHKAI GWGCWC 1 cut(s) 407
BsmI GAATGC 1 cut(s) 263
Bsp1286I GDGCHC 1 cut(s) 407
Bsp143I GATC 4 cut(s) 68, 73, 124, 172
BspCNI CTCAG 2 cut(s) 154, 364
BspLI GGNNCC 1 cut(s) 294
BspPI GGATC 3 cut(s) 76, 119, 180
BspT107I GGYRCC 1 cut(s) 292
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 334
BssMI GATC 4 cut(s) 68, 73, 124, 172
Bst6I CTCTTC 1 cut(s) 26
BstDEI CTNAG 4 cut(s) 87, 141, 207, 372
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 4 cut(s) 71, 76, 127, 175
BstMBI GATC 4 cut(s) 68, 73, 124, 172
BstV1I GCAGC 1 cut(s) 40
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BsuI GTATCC 1 cut(s) 274
BtsCI GGATG 1 cut(s) 109
BtsI GCAGTG 1 cut(s) 53
BtsIMutI CAGTG 2 cut(s) 53, 341
Csp6I GTAC 1 cut(s) 293
CviAII CATG 1 cut(s) 428
CviQI GTAC 1 cut(s) 293
DdeI CTNAG 4 cut(s) 87, 141, 207, 372
DpnI GATC 4 cut(s) 70, 75, 126, 174
DpnII GATC 4 cut(s) 68, 73, 124, 172
Eam1104I CTCTTC 1 cut(s) 26
EarI CTCTTC 1 cut(s) 26
Eco57I CTGAAG 2 cut(s) 50, 264
EcoT22I ATGCAT 1 cut(s) 157
FaeI CATG 1 cut(s) 431
FaiI YATR 5 cut(s) 165, 305, 401, 423, 429
FatI CATG 1 cut(s) 427
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 149
GluI GCNGC 1 cut(s) 54
Hin1II CATG 1 cut(s) 431
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 3 cut(s) 145, 188, 389
HpaI GTTAAC 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 4 cut(s) 73, 144, 235, 244
Hpy188III TCNNGA 1 cut(s) 149
Hpy8I GTNNAC 1 cut(s) 82
HpyCH4V TGCA 2 cut(s) 109, 155
HpyF3I CTNAG 4 cut(s) 87, 141, 207, 372
Hsp92II CATG 1 cut(s) 431
KpnI GGTACC 1 cut(s) 296
KspAI GTTAAC 1 cut(s) 82
Kzo9I GATC 4 cut(s) 68, 73, 124, 172
LpnPI CCDG 2 cut(s) 210, 347
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 3 cut(s) 118, 142, 257
MaeI CTAG 1 cut(s) 149
MalI GATC 4 cut(s) 70, 75, 126, 174
MboI GATC 4 cut(s) 68, 73, 124, 172
MboII GAAGA 4 cut(s) 17, 43, 192, 393
MflI RGATCY 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 407
MluCI AATT 3 cut(s) 323, 357, 384
Mph1103I ATGCAT 1 cut(s) 157
MseI TTAA 2 cut(s) 81, 201
Mva1269I GAATGC 1 cut(s) 263
NdeII GATC 4 cut(s) 68, 73, 124, 172
NlaIII CATG 1 cut(s) 431
NlaIV GGNNCC 1 cut(s) 294
NsiI ATGCAT 1 cut(s) 157
PcsI WCGNNNNNNNCGW 1 cut(s) 337
PctI GAATGC 1 cut(s) 263
PfeI GAWTC 3 cut(s) 145, 188, 389
PkrI GCNGC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 294
PsuI RGATCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
SaqAI TTAA 2 cut(s) 81, 201
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 4 cut(s) 68, 73, 124, 172
SduI GDGCHC 1 cut(s) 407
SetI ASST 4 cut(s) 95, 142, 215, 291
SfaNI GCATC 3 cut(s) 118, 142, 257
SgeI CNNG 9 cut(s) 89, 161, 188, 209, 264, 274, 346, 353, 389
Sse9I AATT 3 cut(s) 323, 357, 384
SspMI CTAG 1 cut(s) 149
TasI AATT 3 cut(s) 323, 357, 384
TfiI GAWTC 3 cut(s) 145, 188, 389
Tru1I TTAA 2 cut(s) 81, 201
Tru9I TTAA 2 cut(s) 81, 201
TscAI CASTG 2 cut(s) 53, 341
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 3 cut(s) 218, 332, 416
TspRI CASTG 2 cut(s) 53, 341
XbaI TCTAGA 1 cut(s) 148
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.