Rh6CG135200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000782
Physical Location & Seq
Reverse (-)
17076248 .. 17098672
22425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG135200.1

Sequence Viewer

Length: 261 bp
ATGGAAGATAAAAGTGTGAGGAAAGGAATGAAGAGATTATTACTGCCGTCTGCTGCTGAAAGAAGTGGATCTGATCGTCTTATCTCTAAGAGGTTTAGAGCAATGTTGCATTCGCTCATCGTTCAAACATTGAATGAACCTCAGAATGTAGATGCATTTGAACATAATGAGAATGAAGTTAGAGGTGATTATCAGCATACTGTTGCACCTCTCCGCAAAGTAATGACAAAGATGTGTTGGTTGAATCTTAGTTATACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.99

Weight (kDa)

9.57

Isoelectric Point (pI)

38.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 214
AclWI GGATC 1 cut(s) 76
AgsI TTSAA 4 cut(s) 125, 133, 161, 244
AlwI GGATC 1 cut(s) 76
ApeKI GCWGC 1 cut(s) 53
AsuHPI GGTGA 1 cut(s) 197
BbvI GCAGC 1 cut(s) 40
BceAI ACGGC 1 cut(s) 31
BfaI CTAG 1 cut(s) 259
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmsI GCATC 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 155
BseXI GCAGC 1 cut(s) 40
BsmI GAATGC 1 cut(s) 109
Bsp143I GATC 2 cut(s) 68, 73
BspACI CCGC 1 cut(s) 214
BspCNI CTCAG 1 cut(s) 154
BspPI GGATC 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 108
BssMI GATC 2 cut(s) 68, 73
Bst4CI ACNGT 1 cut(s) 202
Bst6I CTCTTC 1 cut(s) 26
BstDEI CTNAG 3 cut(s) 87, 141, 248
BstKTI GATC 2 cut(s) 71, 76
BstMBI GATC 2 cut(s) 68, 73
BstV1I GCAGC 1 cut(s) 40
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
DdeI CTNAG 3 cut(s) 87, 141, 248
DpnI GATC 2 cut(s) 70, 75
DpnII GATC 2 cut(s) 68, 73
Eam1104I CTCTTC 1 cut(s) 26
EarI CTCTTC 1 cut(s) 26
EcoT22I ATGCAT 1 cut(s) 157
FaiI YATR 3 cut(s) 165, 198, 255
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 259
GluI GCNGC 1 cut(s) 54
HinfI GANTC 1 cut(s) 244
HphI GGTGA 1 cut(s) 197
Hpy188I TCNGA 2 cut(s) 73, 144
HpyCH4III ACNGT 1 cut(s) 202
HpyCH4V TGCA 3 cut(s) 109, 155, 206
HpyF3I CTNAG 3 cut(s) 87, 141, 248
Kzo9I GATC 2 cut(s) 68, 73
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 259
MalI GATC 2 cut(s) 70, 75
MboI GATC 2 cut(s) 68, 73
MboII GAAGA 2 cut(s) 17, 43
MflI RGATCY 1 cut(s) 68
MnlI CCTC 5 cut(s) 12, 84, 150, 176, 219
Mph1103I ATGCAT 1 cut(s) 157
Mva1269I GAATGC 1 cut(s) 109
NdeII GATC 2 cut(s) 68, 73
NsiI ATGCAT 1 cut(s) 157
PctI GAATGC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 244
PkrI GCNGC 1 cut(s) 55
PsuI RGATCY 1 cut(s) 68
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 68, 73
SetI ASST 5 cut(s) 95, 142, 187, 211, 260
SfaNI GCATC 1 cut(s) 142
SsiI CCGC 1 cut(s) 214
SspMI CTAG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 202
TfiI GAWTC 1 cut(s) 244
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 3 cut(s) 44, 150, 189
XspI CTAG 1 cut(s) 259
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.