RchiOBHm_Chr4g0413151

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
37306377 .. 37308934
2558 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38370

Sequence Viewer

Length: 180 bp
ATGAAGATTCAGGCGATAATATTCATGCATGTAATCATTGCAATGCATGTTTTTGGTTTGGAGAAGCCATTAAACAATCATCGTCCAATGCACCGCTTATCTATACAAGCTGTTGTAAAAAGGGACAAATCAAGCTTGAACAATCGAAACCAACGCCATATTTTCTGGAAAAATTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

7.12

Weight (kDa)

11.49

Isoelectric Point (pI)

56.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 94
AgsI TTSAA 1 cut(s) 139
AluBI AGCT 2 cut(s) 110, 135
AluI AGCT 2 cut(s) 110, 135
Bse3DI GCAATG 2 cut(s) 36, 48
BseMI GCAATG 2 cut(s) 36, 48
BslFI GGGAC 1 cut(s) 137
BsmFI GGGAC 1 cut(s) 137
BspACI CCGC 1 cut(s) 94
BsrDI GCAATG 2 cut(s) 36, 48
BstNSI RCATGY 2 cut(s) 32, 50
CviAII CATG 3 cut(s) 25, 29, 47
CviJI RGCY 3 cut(s) 67, 110, 135
CviKI_1 RGCY 3 cut(s) 67, 110, 135
EcoT22I ATGCAT 2 cut(s) 30, 48
FaeI CATG 3 cut(s) 28, 32, 50
FaiI YATR 5 cut(s) 26, 30, 48, 104, 159
FaqI GGGAC 1 cut(s) 137
FatI CATG 3 cut(s) 24, 28, 46
Hin1II CATG 3 cut(s) 28, 32, 50
HindIII AAGCTT 1 cut(s) 133
HinfI GANTC 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 166
HpyCH4V TGCA 4 cut(s) 28, 41, 46, 91
Hsp92II CATG 3 cut(s) 28, 32, 50
LpnPI CCDG 1 cut(s) 151
MboII GAAGA 1 cut(s) 16
MluCI AATT 1 cut(s) 172
Mph1103I ATGCAT 2 cut(s) 30, 48
MseI TTAA 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 41
NlaIII CATG 3 cut(s) 28, 32, 50
NsiI ATGCAT 2 cut(s) 30, 48
NspI RCATGY 2 cut(s) 32, 50
PfeI GAWTC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 41
SaqAI TTAA 1 cut(s) 71
SetI ASST 2 cut(s) 112, 137
SgeI CNNG 7 cut(s) 23, 37, 41, 59, 119, 144, 148
SmiMI CAYNNNNRTG 1 cut(s) 41
Sse9I AATT 1 cut(s) 172
SsiI CCGC 1 cut(s) 94
SspI AATATT 1 cut(s) 21
TaqI TCGA 1 cut(s) 145
TasI AATT 1 cut(s) 172
TfiI GAWTC 1 cut(s) 7
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 13, 17
XceI RCATGY 2 cut(s) 32, 50
Zsp2I ATGCAT 2 cut(s) 30, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.