Rh5BG226500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000782
Physical Location & Seq
Forward (+)
26471715 .. 26485067
13353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG226500.1

Sequence Viewer

Length: 276 bp
ATGTTTTCTTCGAATGTGTTGCATTCACACATCGTTGAAACATTGAATGAACCTCAGAATGTAGATGCATTTGAACATAATGAGAATGAAGTTAGAGGTGATTATCAGCATACTGTTGCACCTCTCAGCAAAGATGCAGAGATTGGACGAAAGCGCACATTGAGGGGAATGAAGACATTGTTAGAACAGTTTTCTGCTGAAAATTGTGCAATTGGTGAGACAATTGAGCAAGGAAGAACTGACGATAATTTGTTTCATTCAGACATTGTTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.33

Weight (kDa)

4.86

Isoelectric Point (pI)

33.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 38, 46, 74, 272
Alw26I GTCTC 1 cut(s) 212
AspLEI GCGC 1 cut(s) 156
AsuHPI GGTGA 2 cut(s) 110, 227
AsuII TTCGAA 1 cut(s) 11
BbsI GAAGAC 1 cut(s) 179
BcgI CGANNNNNNTGC 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 212
BmsI GCATC 2 cut(s) 55, 124
BpiI GAAGAC 1 cut(s) 179
Bpu14I TTCGAA 1 cut(s) 11
BseMII CTCAG 2 cut(s) 68, 139
BsmAI GTCTC 1 cut(s) 212
BsmI GAATGC 1 cut(s) 22
Bsp119I TTCGAA 1 cut(s) 11
BspCNI CTCAG 2 cut(s) 67, 138
BspT104I TTCGAA 1 cut(s) 11
Bst4CI ACNGT 2 cut(s) 115, 189
BstBI TTCGAA 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 54, 125
BstHHI GCGC 1 cut(s) 156
BstMAI GTCTC 1 cut(s) 212
BstV2I GAAGAC 1 cut(s) 179
CfoI GCGC 1 cut(s) 156
DdeI CTNAG 2 cut(s) 54, 125
EcoT22I ATGCAT 1 cut(s) 70
FaiI YATR 2 cut(s) 78, 111
FspEI CC 9 cut(s) 66, 81, 129, 135, 148, 149, 150, 198, 216
GlaI GCGC 1 cut(s) 155
HhaI GCGC 1 cut(s) 156
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HphI GGTGA 2 cut(s) 110, 227
Hpy188I TCNGA 2 cut(s) 57, 262
HpyCH4III ACNGT 2 cut(s) 115, 189
HpyCH4V TGCA 5 cut(s) 22, 68, 119, 137, 209
HpyF3I CTNAG 2 cut(s) 54, 125
HspAI GCGC 1 cut(s) 154
LweI GCATC 2 cut(s) 55, 124
MboII GAAGA 2 cut(s) 184, 246
MfeI CAATTG 2 cut(s) 210, 222
MluCI AATT 4 cut(s) 202, 210, 222, 247
MnlI CCTC 4 cut(s) 63, 89, 132, 156
Mph1103I ATGCAT 1 cut(s) 70
MunI CAATTG 2 cut(s) 210, 222
Mva1269I GAATGC 1 cut(s) 22
NsiI ATGCAT 1 cut(s) 70
NspV TTCGAA 1 cut(s) 11
PctI GAATGC 1 cut(s) 22
SetI ASST 3 cut(s) 55, 100, 124
SfaNI GCATC 2 cut(s) 55, 124
SfuI TTCGAA 1 cut(s) 11
SgeI CNNG 1 cut(s) 242
Sse9I AATT 4 cut(s) 202, 210, 222, 247
TaaI ACNGT 2 cut(s) 115, 189
TaqI TCGA 1 cut(s) 11
TasI AATT 4 cut(s) 202, 210, 222, 247
TspDTI ATGAA 4 cut(s) 63, 102, 185, 245
Zsp2I ATGCAT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.