RchiOBHm_Chr6g0258091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
13503801 .. 13504118
318 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23143

Sequence Viewer

Length: 168 bp
ATGGGTTCTATGCGAAAAAGTACTTGGATTGTTTTTCTGCCACTGTTCCTGTTTTTGTTCTTTGATATTGATTCGTTGTTCTGTCTTCATTCAGGGGAACCATGCGTCATTTGGGAAGTACTGATGATAATGATTGGATGCCATGAGAAAGTCTGCACCTGCATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.4

Weight (kDa)

5.38

Isoelectric Point (pI)

26.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 22, 120
AjuI GAANNNNNNNTTGG 2 cut(s) 7, 39
BbsI GAAGAC 1 cut(s) 77
BmcAI AGTACT 2 cut(s) 22, 120
BmiI GGNNCC 1 cut(s) 99
BmsI GCATC 1 cut(s) 128
BpiI GAAGAC 1 cut(s) 77
BseGI GGATG 1 cut(s) 143
BsgI GTGCAG 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 45
BstF5I GGATG 1 cut(s) 143
BstV2I GAAGAC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 143
BtsIMutI CAGTG 1 cut(s) 41
CseI GACGC 1 cut(s) 94
Csp6I GTAC 2 cut(s) 21, 119
CviAII CATG 2 cut(s) 102, 143
CviQI GTAC 2 cut(s) 21, 119
FaeI CATG 2 cut(s) 105, 146
FaiI YATR 3 cut(s) 11, 103, 144
FatI CATG 2 cut(s) 101, 142
FokI GGATG 1 cut(s) 150
HgaI GACGC 1 cut(s) 94
Hin1II CATG 2 cut(s) 105, 146
HinfI GANTC 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 156, 162
Hsp92II CATG 2 cut(s) 105, 146
LpnPI CCDG 2 cut(s) 62, 78
LweI GCATC 1 cut(s) 128
MboII GAAGA 1 cut(s) 77
NlaIII CATG 2 cut(s) 105, 146
NlaIV GGNNCC 1 cut(s) 99
PfeI GAWTC 1 cut(s) 71
PspN4I GGNNCC 1 cut(s) 99
RsaI GTAC 2 cut(s) 22, 120
RsaNI GTAC 2 cut(s) 21, 119
ScaI AGTACT 2 cut(s) 22, 120
SetI ASST 1 cut(s) 161
SfaNI GCATC 1 cut(s) 128
SgeI CNNG 5 cut(s) 36, 61, 105, 114, 155
TaaI ACNGT 1 cut(s) 45
TatI WGTACW 2 cut(s) 20, 118
TfiI GAWTC 1 cut(s) 71
TscAI CASTG 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 77
TspRI CASTG 1 cut(s) 48
XcmI CCANNNNNNNNNTGG 1 cut(s) 108
ZrmI AGTACT 2 cut(s) 22, 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.