RLG00000029561

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
40413443 .. 40414228
786 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029561

Sequence Viewer

Length: 312 bp
ATGAAGAGAGTGTTAGAGCAATGTGCTGTTGACAGTTATGATATTAAACGGAGAAGTCAGCAAAGAACAACAAAATGTGATCGTGCTTCTTCTGGTGAAGATAAATGTGATCAAGTTAGTTCAAGGAGATACAAAAGAATGTCTCATGTAGAGTTTGGTCAAGCATCGAATCAATATCAAAATGGCATTGCACTTGAGCATTGTGAGAGACAATCTATGGATGGCAACGAAATTGATAGTCCAGCTGTAGATGAGCATCGATTTATGATCAGTGAAGGCTTCTGGAATTTGATCAATTGGGTGCAGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

12.04

Weight (kDa)

6.28

Isoelectric Point (pI)

67.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 286
AgsI TTSAA 1 cut(s) 123
AluBI AGCT 2 cut(s) 245, 309
AluI AGCT 2 cut(s) 245, 309
Alw26I GTCTC 2 cut(s) 147, 202
ApoI RAATTY 1 cut(s) 286
AsuHPI GGTGA 1 cut(s) 107
BccI CCATC 1 cut(s) 215
BclI TGATCA 3 cut(s) 109, 267, 291
BcoDI GTCTC 2 cut(s) 147, 202
BfmI CTRYAG 1 cut(s) 246
BmsI GCATC 2 cut(s) 173, 265
BpuEI CTTGAG 1 cut(s) 215
Bsa29I ATCGAT 1 cut(s) 259
BsaBI GATNNNNATC 1 cut(s) 255
Bse3DI GCAATG 2 cut(s) 26, 186
Bse8I GATNNNNATC 1 cut(s) 255
BseCI ATCGAT 1 cut(s) 259
BseGI GGATG 1 cut(s) 226
BseJI GATNNNNATC 1 cut(s) 255
BseMI GCAATG 2 cut(s) 26, 186
BshVI ATCGAT 1 cut(s) 259
BsmAI GTCTC 2 cut(s) 147, 202
Bsp143I GATC 4 cut(s) 79, 109, 267, 291
BspDI ATCGAT 1 cut(s) 259
BsrDI GCAATG 2 cut(s) 26, 186
BssMI GATC 4 cut(s) 79, 109, 267, 291
Bst4CI ACNGT 1 cut(s) 35
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 4 cut(s) 82, 112, 270, 294
BstMAI GTCTC 2 cut(s) 147, 202
BstMBI GATC 4 cut(s) 79, 109, 267, 291
BstSFI CTRYAG 1 cut(s) 246
Bsu15I ATCGAT 1 cut(s) 259
BsuTUI ATCGAT 1 cut(s) 259
BtsCI GGATG 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 277
ClaI ATCGAT 1 cut(s) 259
CviAII CATG 1 cut(s) 146
CviJI RGCY 3 cut(s) 245, 279, 309
CviKI_1 RGCY 3 cut(s) 245, 279, 309
DpnI GATC 4 cut(s) 81, 111, 269, 293
DpnII GATC 4 cut(s) 79, 109, 267, 291
FaeI CATG 1 cut(s) 149
FaiI YATR 4 cut(s) 39, 147, 218, 266
FatI CATG 1 cut(s) 145
FbaI TGATCA 3 cut(s) 109, 267, 291
FokI GGATG 1 cut(s) 233
Hin1II CATG 1 cut(s) 149
HincII GTYRAC 1 cut(s) 31
HindII GTYRAC 1 cut(s) 31
HinfI GANTC 1 cut(s) 169
HphI GGTGA 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 283
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 269
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 2 cut(s) 191, 304
Hsp92II CATG 1 cut(s) 149
Ksp22I TGATCA 3 cut(s) 109, 267, 291
Kzo9I GATC 4 cut(s) 79, 109, 267, 291
LpnPI CCDG 3 cut(s) 78, 255, 268
LweI GCATC 2 cut(s) 173, 265
MalI GATC 4 cut(s) 81, 111, 269, 293
MboI GATC 4 cut(s) 79, 109, 267, 291
MboII GAAGA 3 cut(s) 16, 81, 110
MfeI CAATTG 1 cut(s) 295
MluCI AATT 3 cut(s) 231, 286, 295
MseI TTAA 1 cut(s) 45
MspA1I CMGCKG 1 cut(s) 245
MunI CAATTG 1 cut(s) 295
NdeII GATC 4 cut(s) 79, 109, 267, 291
NlaIII CATG 1 cut(s) 149
PfeI GAWTC 1 cut(s) 169
PvuII CAGCTG 1 cut(s) 245
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 4 cut(s) 79, 109, 267, 291
SetI ASST 2 cut(s) 247, 311
SfaNI GCATC 2 cut(s) 173, 265
SfcI CTRYAG 1 cut(s) 246
SgeI CNNG 9 cut(s) 95, 105, 125, 135, 158, 173, 206, 254, 295
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 3 cut(s) 231, 286, 295
TaaI ACNGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 167, 259
TasI AATT 3 cut(s) 231, 286, 295
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 1 cut(s) 277
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 64
TspRI CASTG 1 cut(s) 277
XapI RAATTY 1 cut(s) 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.