RchiOBHm_Chr7g0215701

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000782
Physical Location & Seq
Reverse (-)
33368608 .. 33371152
2545 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19300

Sequence Viewer

Length: 240 bp
ATGCAAAGGAGTATCTGGATTGTTCTTTTGCCTCTATTCCTGGTTTTGTTGCTTGGTGTTAGTTTGGTGTCCTATTGTTATTCTGATATTGGGAACAGTGAGCGATCAAAATCTACAAATTTTCTGGACTCAGTGATGGCATCTACGAGCACAACGAAACTGGTTAAAAGATTGTTGGAAGGAGTATGTAAATCTAATCAATTTGATCAAGTTAATTCAAAGAGATGGAAAAGAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.01

Weight (kDa)

9.83

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 118
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 1 cut(s) 39
Alw21I GWGCWC 1 cut(s) 152
ApoI RAATTY 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 152
BccI CCATC 2 cut(s) 130, 219
BciT130I CCWGG 1 cut(s) 41
BclI TGATCA 1 cut(s) 205
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BmsI GCATC 1 cut(s) 149
BsaBI GATNNNNATC 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 165
Bse8I GATNNNNATC 1 cut(s) 109
BseBI CCWGG 1 cut(s) 41
BseJI GATNNNNATC 1 cut(s) 109
BseMII CTCAG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 165
BsiHKAI GWGCWC 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 104, 205
BspCNI CTCAG 1 cut(s) 143
BsrI ACTGG 1 cut(s) 165
BssMI GATC 2 cut(s) 104, 205
Bst2UI CCWGG 1 cut(s) 41
Bst4CI ACNGT 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 130
BstKTI GATC 2 cut(s) 107, 208
BstMBI GATC 2 cut(s) 104, 205
BstNI CCWGG 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 39
BtsIMutI CAGTG 2 cut(s) 103, 138
DdeI CTNAG 1 cut(s) 130
DpnI GATC 2 cut(s) 106, 207
DpnII GATC 2 cut(s) 104, 205
EcoRII CCWGG 1 cut(s) 39
FaiI YATR 2 cut(s) 187, 238
FbaI TGATCA 1 cut(s) 205
HinfI GANTC 1 cut(s) 128
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 2 cut(s) 16, 125
HpyAV CCTTC 1 cut(s) 173
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 130
Ksp22I TGATCA 1 cut(s) 205
Kzo9I GATC 2 cut(s) 104, 205
LpnPI CCDG 4 cut(s) 26, 53, 110, 146
LweI GCATC 1 cut(s) 149
MalI GATC 2 cut(s) 106, 207
MboI GATC 2 cut(s) 104, 205
MhlI GDGCHC 1 cut(s) 152
MluCI AATT 3 cut(s) 118, 200, 214
MlyI GAGTC 1 cut(s) 122
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 1 cut(s) 42
MseI TTAA 2 cut(s) 165, 213
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
NdeII GATC 2 cut(s) 104, 205
PcsI WCGNNNNNNNCGW 1 cut(s) 152
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
SaqAI TTAA 2 cut(s) 165, 213
Sau3AI GATC 2 cut(s) 104, 205
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 41
SduI GDGCHC 1 cut(s) 152
SfaNI GCATC 1 cut(s) 149
SgeI CNNG 8 cut(s) 28, 52, 53, 65, 137, 159, 173, 221
Sse9I AATT 3 cut(s) 118, 200, 214
StyD4I CCNGG 1 cut(s) 39
TaaI ACNGT 1 cut(s) 98
TasI AATT 3 cut(s) 118, 200, 214
Tru1I TTAA 2 cut(s) 165, 213
Tru9I TTAA 2 cut(s) 165, 213
TscAI CASTG 2 cut(s) 103, 138
TspRI CASTG 2 cut(s) 103, 138
XapI RAATTY 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.