RchiOBHm_Chr5g0050891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
51602856 .. 51603080
225 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32841

Sequence Viewer

Length: 156 bp
ATGCAAAAGAGTTTCTGGATTGTTGTTCTCCCACTGTTTCTGATTTTGTTATTTGGTGTTAGTTCAGCGTGCTCTTTTGATTCAGGATATGTCATTCGATTGAGGATTTATATTGTAACTGTTGATCTATGTTATATTATTTTTGATACTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.88

Weight (kDa)

5.79

Isoelectric Point (pI)

28.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw21I GWGCWC 1 cut(s) 74
Bbv12I GWGCWC 1 cut(s) 74
BsiHKAI GWGCWC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 124
BssMI GATC 1 cut(s) 124
Bst4CI ACNGT 3 cut(s) 36, 121, 151
BstC8I GCNNGC 1 cut(s) 70
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 32
Cac8I GCNNGC 1 cut(s) 70
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
FaiI YATR 4 cut(s) 90, 111, 130, 135
FspEI CC 5 cut(s) 39, 44, 45, 69, 88
HinfI GANTC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 16, 84
HpyCH4III ACNGT 3 cut(s) 36, 121, 151
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 115
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MhlI GDGCHC 1 cut(s) 74
MnlI CCTC 1 cut(s) 96
NdeII GATC 1 cut(s) 124
PfeI GAWTC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 124
SduI GDGCHC 1 cut(s) 74
SgeI CNNG 3 cut(s) 28, 81, 96
TaaI ACNGT 3 cut(s) 36, 121, 151
TaqI TCGA 1 cut(s) 97
TfiI GAWTC 1 cut(s) 80
TscAI CASTG 1 cut(s) 39
TspRI CASTG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.