Rh5CG231500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
24017021 .. 24026707
9687 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG231500.1

Sequence Viewer

Length: 375 bp
ATGGCGTCAGAAAATATGATGAGGGGAAGAAAAAGATTATTAATACAGTGTGCTGCTGGAAGTAATGAAAGTAAAGACACAATTGAGCAAAGGAGAACTAAACGTAATCGTGTTTTTTTTGGTGGAGATGAATATGATCGAATTAACTCAGAGAGATGGAAAACGATGTTTGATCCTCAAATTGCTGAAGCATCAAATGTATGTGAGAATGTCACTAGAATTGAACATTCTGACAAACAATGTAGAGCTGACGACCAAAATGTTGGTGCAACTCTAAATGAAGATCCATTTATGGGTCTAGAAGTAGTAGTTATCAAAACAATACTTACGGGACATAGTTCTCTAACATTTTCTATAAGTCGTTTCAAATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

14.22

Weight (kDa)

7.73

Isoelectric Point (pI)

44.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 167, 278
AcsI RAATTY 1 cut(s) 368
AcuI CTGAAG 1 cut(s) 207
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 293
AgsI TTSAA 2 cut(s) 224, 367
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
AlwI GGATC 2 cut(s) 167, 278
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 368
AseI ATTAAT 1 cut(s) 41
BbvI GCAGC 1 cut(s) 40
BccI CCATC 1 cut(s) 150
BfaI CTAG 3 cut(s) 216, 299, 373
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmsI GCATC 1 cut(s) 200
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 293
BseLI CCNNNNNNNGG 1 cut(s) 293
BseMII CTCAG 1 cut(s) 162
BseXI GCAGC 1 cut(s) 40
BslFI GGGAC 1 cut(s) 345
BslI CCNNNNNNNGG 1 cut(s) 293
BsmFI GGGAC 1 cut(s) 345
Bsp143I GATC 3 cut(s) 136, 172, 283
BspCNI CTCAG 1 cut(s) 161
BspPI GGATC 2 cut(s) 167, 278
BssMI GATC 3 cut(s) 136, 172, 283
BssNI GRCGYC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 48
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 1 cut(s) 148
BstKTI GATC 3 cut(s) 139, 175, 286
BstMBI GATC 3 cut(s) 136, 172, 283
BstV1I GCAGC 1 cut(s) 40
BstX2I RGATCY 1 cut(s) 283
BstXI CCANNNNNNTGG 1 cut(s) 263
BstYI RGATCY 1 cut(s) 283
BtsIMutI CAGTG 1 cut(s) 53
CviJI RGCY 1 cut(s) 248
CviKI_1 RGCY 1 cut(s) 248
DdeI CTNAG 1 cut(s) 148
DpnI GATC 3 cut(s) 138, 174, 285
DpnII GATC 3 cut(s) 136, 172, 283
Eco57I CTGAAG 1 cut(s) 207
FaiI YATR 6 cut(s) 17, 135, 202, 293, 336, 356
FaqI GGGAC 1 cut(s) 345
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 3 cut(s) 216, 299, 373
GluI GCNGC 1 cut(s) 54
Hin1I GRCGYC 1 cut(s) 5
Hpy188I TCNGA 3 cut(s) 10, 151, 232
Hpy188III TCNNGA 1 cut(s) 299
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4IV ACGT 1 cut(s) 103
HpyCH4V TGCA 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 148
HpySE526I ACGT 1 cut(s) 103
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 3 cut(s) 136, 172, 283
LpnPI CCDG 1 cut(s) 42
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 1 cut(s) 200
MaeI CTAG 3 cut(s) 216, 299, 373
MaeII ACGT 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 211
MalI GATC 3 cut(s) 138, 174, 285
MboI GATC 3 cut(s) 136, 172, 283
MboII GAAGA 2 cut(s) 39, 293
MfeI CAATTG 1 cut(s) 81
MflI RGATCY 1 cut(s) 283
MluCI AATT 5 cut(s) 81, 141, 180, 219, 368
MnlI CCTC 2 cut(s) 15, 186
MseI TTAA 2 cut(s) 41, 144
MunI CAATTG 1 cut(s) 81
NdeII GATC 3 cut(s) 136, 172, 283
NmuCI GTSAC 1 cut(s) 211
PkrI GCNGC 1 cut(s) 55
PshBI ATTAAT 1 cut(s) 41
PsuI RGATCY 1 cut(s) 283
SaqAI TTAA 2 cut(s) 41, 144
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 3 cut(s) 136, 172, 283
SetI ASST 2 cut(s) 106, 250
SfaNI GCATC 1 cut(s) 200
SgeI CNNG 5 cut(s) 69, 122, 228, 311, 342
Sse9I AATT 5 cut(s) 81, 141, 180, 219, 368
SspMI CTAG 3 cut(s) 216, 299, 373
TaaI ACNGT 1 cut(s) 48
TaiI ACGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 139
TasI AATT 5 cut(s) 81, 141, 180, 219, 368
Tru1I TTAA 2 cut(s) 41, 144
Tru9I TTAA 2 cut(s) 41, 144
TscAI CASTG 1 cut(s) 53
TseFI GTSAC 1 cut(s) 211
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 211
TspDTI ATGAA 3 cut(s) 81, 144, 294
TspRI CASTG 1 cut(s) 53
VspI ATTAAT 1 cut(s) 41
XapI RAATTY 1 cut(s) 368
XbaI TCTAGA 1 cut(s) 298
XspI CTAG 3 cut(s) 216, 299, 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.