Rmu_co8451143.1_g000001

Major pollen allergen Ole e 10-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8451143.1
OG0000486
Physical Location & Seq
Forward (+)
1 .. 1699
1699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8451143.1_g000001.1.cds

Sequence Viewer

Length: 437 bp
gccgggctgggcttttagccctcagggccggcgggcctccatcggcccacttgatccgcgggctttttgatgaggcctataatatggtaactatagaacatgtaaaggacataaggatgagaacaggttacattgactactccaattccaagcgagggcctataaaggttgttagtgaggatgagaataagacctggtgtgttgctaagccttcagcaactgattcagagctctctgcaaacattcagtttgcctgcaaccaattgaaggattgcaaggtgatacaagaaggaggctcatgctataaccccaactcactcattaaccatgcctcagtggtgatgaatctttactataaagcggtaggccaaaacagctggaattgtgacttcagaggatctgctctcatcactcagactaatccaagtaatgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
X8

Protein Analysis

144

Amino Acids

15.87

Weight (kDa)

7.8

Isoelectric Point (pI)

30.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000486)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G29735 AT4G09090 AT4G09462 AT4G09464 AT4G09465 AT4G09466 AT4G09467 AT5G53600 AT5G53610 AT5G63225 AT5G63230
fragaria_vesca FvH4_3g06020 FvH4_3g06020 FvH4_3g06020 FvH4_3g06030 FvH4_3g06030 FvH4_3g06030 FvH4_3g06030 FvH4_3g06040 FvH4_4g08590 FvH4_6g37860
malus_domestica MD10G1265100.v1.1
prunus_persica Prupe.4G076700_v2.0.a1 Prupe.4G076900_v2.0.a1 Prupe.4G084600_v2.0.a1 Prupe.4G130100_v2.0.a1 Prupe.6G294200_v2.0.a1
pyrus_communis pycom05g26640 pycom10g22110
rosa_chinensis RchiOBHm_Chr5g0013281 RchiOBHm_Chr5g0013291 RchiOBHm_Chr5g0013321 RchiOBHm_Chr5g0013341 RchiOBHm_Chr5g0013351 RchiOBHm_Chr5g0013361 RchiOBHm_Chr5g0013371 RchiOBHm_Chr5g0013381 RchiOBHm_Chr5g0013391
rosa_laevigata RLG00000032004 RLG00000032005 RLG00000032008 RLG00000032012 RLG00000032013 RLG00000032014 RLG00000032015 RLG00000032016
rosa_multiflora Rmu_co8200260.1_g000001 Rmu_co8451143.1_g000001 Rmu_sc0003458.1_g000006 Rmu_sc0003458.1_g000008 Rmu_sc0003458.1_g000009 Rmu_sc0003458.1_g000012 Rmu_sc0003458.1_g000014 Rmu_sc0010713.1_g000001
rosa_roxburghii Rroxscaffold_1G00063160 Rroxscaffold_1G00063170 Rroxscaffold_1G00063180 Rroxscaffold_1G00063190 Rroxscaffold_1G00063200 Rroxscaffold_1G00063210
rosa_rugosa Rorug05G0008700 Rorug05G0008700 Rorug05G0008800 Rorug05G0008800 Rorug05G0008900.1 Rorug05G0009000 Rorug05G0009000 Rorug05G0009000
rosa_samantha Rh5AG103700 Rh5AG103800 Rh5AG104000 Rh5AG104300 Rh5AG104400 Rh5BG100300 Rh5BG100400 Rh5BG100500 Rh5BG100600 Rh5BG100700 Rh5CG111500 Rh5CG111600 Rh5CG112000 Rh5CG112200 Rh5CG112300 Rh5CG112500 Rh5DG099200 Rh5DG099300
rosa_wichuraiana Rw5G009040 Rw5G009050 Rw5G009080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 59
AciI CCGC 4 cut(s) 32, 57, 59, 361
AclWI GGATC 2 cut(s) 48, 405
AcuI CTGAAG 2 cut(s) 197, 375
AfiI CCNNNNNNNGG 2 cut(s) 155, 267
AflIII ACRYGT 1 cut(s) 99
AgsI TTSAA 1 cut(s) 267
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 2 cut(s) 231, 377
AluI AGCT 2 cut(s) 231, 377
Alw21I GWGCWC 1 cut(s) 233
AlwI GGATC 2 cut(s) 48, 405
AlwNI CAGNNNCTG 1 cut(s) 220
AoxI GGCC 6 cut(s) 26, 34, 44, 74, 157, 366
AspS9I GGNCC 4 cut(s) 26, 34, 45, 157
AsuC2I CCSGG 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 291, 351
AxyI CCTNAGG 1 cut(s) 22
BanII GRGCYC 1 cut(s) 233
Bbv12I GWGCWC 1 cut(s) 233
BccI CCATC 1 cut(s) 48
BciT130I CCWGG 1 cut(s) 195
BcnI CCSGG 1 cut(s) 4
BfmI CTRYAG 1 cut(s) 92
BglI GCCNNNNNGGC 1 cut(s) 25
BlpI GCTNAGC 1 cut(s) 206
Bme1390I CCNGG 2 cut(s) 4, 195
BmgT120I GGNCC 4 cut(s) 26, 34, 45, 157
BmrFI CCNGG 2 cut(s) 4, 195
Bpu1102I GCTNAGC 1 cut(s) 206
BpuMI CCSGG 1 cut(s) 4
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 2 cut(s) 155, 267
Bse118I RCCGGY 1 cut(s) 28
Bse21I CCTNAGG 1 cut(s) 22
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 2 cut(s) 122, 186
BseLI CCNNNNNNNGG 2 cut(s) 155, 267
BseMII CTCAG 3 cut(s) 36, 347, 427
BseYI CCCAGC 1 cut(s) 7
Bsh1236I CGCG 1 cut(s) 59
BshFI GGCC 6 cut(s) 28, 36, 46, 76, 159, 368
BsiHKAI GWGCWC 1 cut(s) 233
BsiSI CCGG 2 cut(s) 3, 29
BslI CCNNNNNNNGG 2 cut(s) 155, 267
BsnI GGCC 6 cut(s) 28, 36, 46, 76, 159, 368
Bsp1286I GDGCHC 1 cut(s) 233
Bsp143I GATC 2 cut(s) 53, 397
Bsp1720I GCTNAGC 1 cut(s) 206
BspACI CCGC 4 cut(s) 32, 57, 59, 361
BspANI GGCC 6 cut(s) 28, 36, 46, 76, 159, 368
BspCNI CTCAG 3 cut(s) 35, 346, 426
BspFNI CGCG 1 cut(s) 59
BspPI GGATC 2 cut(s) 48, 405
BsrFI RCCGGY 1 cut(s) 28
BssAI RCCGGY 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 2 cut(s) 53, 397
Bst2UI CCWGG 1 cut(s) 195
BstC8I GCNNGC 4 cut(s) 30, 34, 61, 255
BstDEI CTNAG 4 cut(s) 22, 206, 333, 413
BstDSI CCRYGG 1 cut(s) 57
BstF5I GGATG 2 cut(s) 122, 186
BstFNI CGCG 1 cut(s) 59
BstKTI GATC 2 cut(s) 56, 400
BstMBI GATC 2 cut(s) 53, 397
BstMWI GCNNNNNNNGC 2 cut(s) 25, 374
BstNI CCWGG 1 cut(s) 195
BstNSI RCATGY 1 cut(s) 103
BstSCI CCNGG 2 cut(s) 2, 193
BstSFI CTRYAG 1 cut(s) 92
BstUI CGCG 1 cut(s) 59
BstX2I RGATCY 1 cut(s) 397
BstYI RGATCY 1 cut(s) 397
Bsu36I CCTNAGG 1 cut(s) 22
BsuRI GGCC 6 cut(s) 28, 36, 46, 76, 159, 368
BtgI CCRYGG 1 cut(s) 57
BtsCI GGATG 2 cut(s) 122, 186
BtsIMutI CAGTG 1 cut(s) 341
Cac8I GCNNGC 4 cut(s) 30, 34, 61, 255
CaiI CAGNNNCTG 1 cut(s) 220
Cfr10I RCCGGY 1 cut(s) 28
Cfr13I GGNCC 4 cut(s) 26, 34, 45, 157
Cfr42I CCGCGG 1 cut(s) 60
CsiI ACCWGGT 1 cut(s) 193
CviAII CATG 3 cut(s) 100, 299, 328
DdeI CTNAG 4 cut(s) 22, 206, 333, 413
DpnI GATC 2 cut(s) 55, 399
DpnII GATC 2 cut(s) 53, 397
Ecl136II GAGCTC 1 cut(s) 231
Eco147I AGGCCT 1 cut(s) 76
Eco24I GRGCYC 1 cut(s) 233
Eco53kI GAGCTC 1 cut(s) 231
Eco57I CTGAAG 2 cut(s) 197, 375
Eco81I CCTNAGG 1 cut(s) 22
EcoICRI GAGCTC 1 cut(s) 231
EcoO109I RGGNCCY 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 193
EcoT38I GRGCYC 1 cut(s) 233
FaeI CATG 3 cut(s) 103, 302, 331
FatI CATG 3 cut(s) 99, 298, 327
FauI CCCGC 2 cut(s) 25, 52
FokI GGATG 2 cut(s) 129, 193
FriOI GRGCYC 1 cut(s) 233
GsaI CCCAGC 1 cut(s) 11
HaeIII GGCC 6 cut(s) 28, 36, 46, 76, 159, 368
HapII CCGG 2 cut(s) 3, 29
Hin1II CATG 3 cut(s) 103, 302, 331
HinfI GANTC 2 cut(s) 223, 345
HpaII CCGG 2 cut(s) 3, 29
HphI GGTGA 2 cut(s) 291, 351
Hpy188I TCNGA 3 cut(s) 228, 394, 416
HpyAV CCTTC 3 cut(s) 221, 261, 283
HpyCH4V TGCA 3 cut(s) 238, 257, 275
HpyF10VI GCNNNNNNNGC 2 cut(s) 25, 374
HpyF3I CTNAG 4 cut(s) 22, 206, 333, 413
Hsp92II CATG 3 cut(s) 103, 302, 331
KroI GCCGGC 1 cut(s) 28
KroNI GCCGGC 1 cut(s) 30
KspI CCGCGG 1 cut(s) 60
Kzo9I GATC 2 cut(s) 53, 397
LpnPI CCDG 8 cut(s) 9, 16, 42, 110, 180, 207, 267, 363
MabI ACCWGGT 1 cut(s) 193
MaeIII GTNAC 3 cut(s) 87, 127, 385
MalI GATC 2 cut(s) 55, 399
MboI GATC 2 cut(s) 53, 397
MfeI CAATTG 1 cut(s) 262
MflI RGATCY 1 cut(s) 397
MhlI GDGCHC 1 cut(s) 233
MluCI AATT 3 cut(s) 144, 262, 381
MnlI CCTC 8 cut(s) 31, 47, 66, 148, 171, 286, 342, 388
MroNI GCCGGC 1 cut(s) 28
MseI TTAA 1 cut(s) 323
MslI CAYNNNNRTG 1 cut(s) 115
MspA1I CMGCKG 2 cut(s) 59, 377
MspI CCGG 2 cut(s) 3, 29
MspR9I CCNGG 2 cut(s) 4, 195
MunI CAATTG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 195
MvnI CGCG 1 cut(s) 59
MwoI GCNNNNNNNGC 2 cut(s) 25, 374
NaeI GCCGGC 1 cut(s) 30
NciI CCSGG 1 cut(s) 4
NdeII GATC 2 cut(s) 53, 397
NgoMIV GCCGGC 1 cut(s) 28
NlaIII CATG 3 cut(s) 103, 302, 331
NmuCI GTSAC 1 cut(s) 385
NspI RCATGY 1 cut(s) 103
PceI AGGCCT 1 cut(s) 76
PciI ACATGT 1 cut(s) 99
PdiI GCCGGC 1 cut(s) 30
PfeI GAWTC 2 cut(s) 223, 345
PscI ACATGT 1 cut(s) 99
Psp124BI GAGCTC 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 193
PspFI CCCAGC 1 cut(s) 7
PspGI CCWGG 1 cut(s) 193
PspPI GGNCC 4 cut(s) 26, 34, 45, 157
PstNI CAGNNNCTG 1 cut(s) 220
PsuI RGATCY 1 cut(s) 397
PvuII CAGCTG 1 cut(s) 377
RseI CAYNNNNRTG 1 cut(s) 115
SacI GAGCTC 1 cut(s) 233
SacII CCGCGG 1 cut(s) 60
SaqAI TTAA 1 cut(s) 323
Sau3AI GATC 2 cut(s) 53, 397
Sau96I GGNCC 4 cut(s) 26, 34, 45, 157
ScrFI CCNGG 2 cut(s) 4, 195
SduI GDGCHC 1 cut(s) 233
SetI ASST 6 cut(s) 129, 170, 196, 233, 281, 379
SexAI ACCWGGT 1 cut(s) 193
SfcI CTRYAG 1 cut(s) 92
Sfr303I CCGCGG 1 cut(s) 60
SgrBI CCGCGG 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 115
Sse9I AATT 3 cut(s) 144, 262, 381
SseBI AGGCCT 1 cut(s) 76
SsiI CCGC 4 cut(s) 32, 57, 59, 361
SstI GAGCTC 1 cut(s) 233
StuI AGGCCT 1 cut(s) 76
StyD4I CCNGG 2 cut(s) 2, 193
TasI AATT 3 cut(s) 144, 262, 381
TfiI GAWTC 2 cut(s) 223, 345
Tru1I TTAA 1 cut(s) 323
Tru9I TTAA 1 cut(s) 323
TscAI CASTG 1 cut(s) 341
TseFI GTSAC 1 cut(s) 385
Tsp45I GTSAC 1 cut(s) 385
TspDTI ATGAA 1 cut(s) 358
TspRI CASTG 1 cut(s) 341
XceI RCATGY 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.