Rmu_sc0000968.1_g000005

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000968.1
OG0000698
Physical Location & Seq
Reverse (-)
17919 .. 18149
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000968.1_g000005.1.cds

Sequence Viewer

Length: 231 bp
atgtttgcccttttagtcaaagtgtttcgccttgttgatggggatagaaaaccatcaatgggctttgtgtatggagaactacttagagccaaagaggagattaaaatggcattcaaagatcaagaagctcactatcattcaatctttgacattgttgatggaaaagcccgtgatcgacttgatactccattgcatttagcgggctacctcttgaacccttactacacatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT

Protein Analysis

76

Amino Acids

8.84

Weight (kDa)

6.82

Isoelectric Point (pI)

18.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000698)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G43260 AT5G31412
fragaria_vesca FvH4_2g24751 FvH4_3g29751 FvH4_3g29752 FvH4_3g32705 FvH4_4g20841 FvH4_5g39742 FvH4_6g06672 FvH4_6g28272 FvH4_6g28273 FvH4_7g00215
malus_domestica MD07G1147000.v1.1
prunus_persica Prupe.4G255800_v2.0.a1
pyrus_communis pycom09g15950 pycom10g13140
rosa_chinensis RchiOBHm_Chr1g0314441 RchiOBHm_Chr1g0314451 RchiOBHm_Chr4g0430441 RchiOBHm_Chr4g0430831 RchiOBHm_Chr5g0003001 RchiOBHm_Chr5g0033441 RchiOBHm_Chr6g0251571 RchiOBHm_Chr6g0288501
rosa_multiflora Rmu_co8007098.1_g000001 Rmu_co8211970.1_g000002 Rmu_sc0000146.1_g000031 Rmu_sc0000555.1_g000022 Rmu_sc0000968.1_g000005 Rmu_sc0001017.1_g000028 Rmu_sc0001208.1_g000044 Rmu_sc0001526.1_g000038 Rmu_sc0002226.1_g000026 Rmu_sc0002284.1_g000006 Rmu_sc0002776.1_g000004 Rmu_sc0003369.1_g000011 Rmu_sc0003632.1_g000005 Rmu_sc0004180.1_g000007 Rmu_sc0004180.1_g000008 Rmu_sc0005014.1_g000005 Rmu_sc0005023.1_g000011 Rmu_sc0007296.1_g000009 Rmu_sc0011153.1_g000002 Rmu_sc0011153.1_g000003 Rmu_sc0018472.1_g000003 Rmu_sc0020646.1_g000001 Rmu_sc0022773.1_g000001 Rmu_sc0022773.1_g000002 Rmu_sc0023555.1_g000001 Rmu_sc0023788.1_g000001 Rmu_ssc0000409.1_g000026 Rmu_ssc0000421.1_g000039
rosa_roxburghii Rroxscaffold_2G00091530 Rroxscaffold_5G00355490 Rroxscaffold_6G00405690 Rroxscaffold_6G00412290 Rroxscaffold_7G00195870
rosa_rugosa Rorug05G0244000
rosa_samantha Rh3DG075100
rosa_wichuraiana Rw0G014340 Rw1G023020 Rw2G020120 Rw2G033790 Rw2G035670 Rw3G022290 Rw3G023070 Rw3G023080 Rw4G003460 Rw4G017840 Rw4G032430 Rw5G024280 Rw5G044440 Rw6G027410 Rw7G020330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 3 cut(s) 115, 141, 214
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
BccI CCATC 3 cut(s) 32, 61, 152
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse3DI GCAATG 1 cut(s) 188
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMI GCAATG 1 cut(s) 188
BseRI GAGGAG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 59
BsmI GAATGC 1 cut(s) 110
Bsp143I GATC 2 cut(s) 118, 172
BspACI CCGC 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 188
BssMI GATC 2 cut(s) 118, 172
BstC8I GCNNGC 1 cut(s) 202
BstDEI CTNAG 1 cut(s) 83
BstKTI GATC 2 cut(s) 121, 175
BstMBI GATC 2 cut(s) 118, 172
Cac8I GCNNGC 1 cut(s) 202
CviAII CATG 1 cut(s) 228
CviJI RGCY 5 cut(s) 63, 89, 128, 167, 204
CviKI_1 RGCY 5 cut(s) 63, 89, 128, 167, 204
DdeI CTNAG 1 cut(s) 83
DpnI GATC 2 cut(s) 120, 174
DpnII GATC 2 cut(s) 118, 172
FaeI CATG 1 cut(s) 231
FaiI YATR 2 cut(s) 72, 229
FatI CATG 1 cut(s) 227
FauI CCCGC 1 cut(s) 193
Hin1II CATG 1 cut(s) 231
Hpy188III TCNNGA 2 cut(s) 122, 211
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 1 cut(s) 83
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 2 cut(s) 118, 172
MalI GATC 2 cut(s) 120, 174
MboI GATC 2 cut(s) 118, 172
MnlI CCTC 2 cut(s) 88, 218
MseI TTAA 1 cut(s) 102
Mva1269I GAATGC 1 cut(s) 110
NdeII GATC 2 cut(s) 118, 172
NlaIII CATG 1 cut(s) 231
PctI GAATGC 1 cut(s) 110
PsrI GAACNNNNNNTAC 1 cut(s) 206
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 2 cut(s) 118, 172
SetI ASST 2 cut(s) 130, 210
SgeI CNNG 7 cut(s) 44, 134, 180, 182, 191, 213, 223
SsiI CCGC 1 cut(s) 200
TaqI TCGA 1 cut(s) 175
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.