Rmu_ssc0000409.1_g000026

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000409.1
OG0000698
Physical Location & Seq
Reverse (-)
84517 .. 85761
1245 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000409.1_g000026.1.cds

Sequence Viewer

Length: 858 bp
atggagaagaagaatgagttgagagctatgattactaatggtgaatggaatgaaaaaaagcatgcaaagagtgtaaaggacaatgcggcaatgaatatcgctttgagtgcttcttttttaaatggagtaagtctttgcttgaatgtgtttgcccctttagtcaaagtgcttctccttgttaatggagataaaaagctcaaagatcaagaagctcactatcgtccaatctttgagattgttgatgggaaagctcgtgatcaacttgatagttcattgcatttagcgagctacctcttgaaccatttatacacatatgtcaatccaagcattggaaatgataatgtggtcatggatgggttctttacttgtgttgaggtattctttcccgatgacattcaaactcaaaatttggtgacaaatgtggaattgcacaagtatttgaagaaagatggtggatttggaaaagctttagctaaggtgggatgcacacaaaatgatgacaattatgatccggtctatgtccaattcaaggccaagatcatcaacaggaagagaagaatgaaagaaaagaatgtggatgtactacttgctagtgaagctactatgacacaaggatggattgttgatggtggtgatgaagatgttgagtcagatcttactagtgaaatcattggagaggaatcgggagtggatagtggcttagagcctaggaggagttctacacttcaagaaattagggaacttcatgaggaagattttgtatcggatgaagaggaagaagatgagatggattttcagtttgagtctgatatggagggagtactagagggatatagagaagaagaatttgaggaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT

Protein Analysis

285

Amino Acids

32.35

Weight (kDa)

4.55

Isoelectric Point (pI)

35.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000698)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G43260 AT5G31412
fragaria_vesca FvH4_2g24751 FvH4_3g29751 FvH4_3g29752 FvH4_3g32705 FvH4_4g20841 FvH4_5g39742 FvH4_6g06672 FvH4_6g28272 FvH4_6g28273 FvH4_7g00215
malus_domestica MD07G1147000.v1.1
prunus_persica Prupe.4G255800_v2.0.a1
pyrus_communis pycom09g15950 pycom10g13140
rosa_chinensis RchiOBHm_Chr1g0314441 RchiOBHm_Chr1g0314451 RchiOBHm_Chr4g0430441 RchiOBHm_Chr4g0430831 RchiOBHm_Chr5g0003001 RchiOBHm_Chr5g0033441 RchiOBHm_Chr6g0251571 RchiOBHm_Chr6g0288501
rosa_multiflora Rmu_co8007098.1_g000001 Rmu_co8211970.1_g000002 Rmu_sc0000146.1_g000031 Rmu_sc0000555.1_g000022 Rmu_sc0000968.1_g000005 Rmu_sc0001017.1_g000028 Rmu_sc0001208.1_g000044 Rmu_sc0001526.1_g000038 Rmu_sc0002226.1_g000026 Rmu_sc0002284.1_g000006 Rmu_sc0002776.1_g000004 Rmu_sc0003369.1_g000011 Rmu_sc0003632.1_g000005 Rmu_sc0004180.1_g000007 Rmu_sc0004180.1_g000008 Rmu_sc0005014.1_g000005 Rmu_sc0005023.1_g000011 Rmu_sc0007296.1_g000009 Rmu_sc0011153.1_g000002 Rmu_sc0011153.1_g000003 Rmu_sc0018472.1_g000003 Rmu_sc0020646.1_g000001 Rmu_sc0022773.1_g000001 Rmu_sc0022773.1_g000002 Rmu_sc0023555.1_g000001 Rmu_sc0023788.1_g000001 Rmu_ssc0000409.1_g000026 Rmu_ssc0000421.1_g000039
rosa_roxburghii Rroxscaffold_2G00091530 Rroxscaffold_5G00355490 Rroxscaffold_6G00405690 Rroxscaffold_6G00412290 Rroxscaffold_7G00195870
rosa_rugosa Rorug05G0244000
rosa_samantha Rh3DG075100
rosa_wichuraiana Rw0G014340 Rw1G023020 Rw2G020120 Rw2G033790 Rw2G035670 Rw3G022290 Rw3G023070 Rw3G023080 Rw4G003460 Rw4G017840 Rw4G032430 Rw5G024280 Rw5G044440 Rw6G027410 Rw7G020330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 329
AciI CCGC 1 cut(s) 86
AclWI GGATC 1 cut(s) 503
AcsI RAATTY 2 cut(s) 406, 845
AfaI GTAC 2 cut(s) 582, 822
AfiI CCNNNNNNNGG 2 cut(s) 329, 529
AgsI TTSAA 6 cut(s) 142, 298, 398, 442, 529, 728
AhlI ACTAGT 1 cut(s) 659
AluBI AGCT 8 cut(s) 26, 196, 212, 251, 288, 467, 473, 599
AluI AGCT 8 cut(s) 26, 196, 212, 251, 288, 467, 473, 599
AlwI GGATC 1 cut(s) 503
AoxI GGCC 1 cut(s) 531
ApoI RAATTY 2 cut(s) 406, 845
AspA2I CCTAGG 1 cut(s) 707
AsuHPI GGTGA 3 cut(s) 53, 424, 644
AvrII CCTAGG 1 cut(s) 707
BauI CACGAG 1 cut(s) 252
BccI CCATC 6 cut(s) 236, 347, 443, 609, 620, 781
BclI TGATCA 1 cut(s) 256
BcuI ACTAGT 1 cut(s) 659
BfaI CTAG 4 cut(s) 591, 660, 708, 824
BglII AGATCT 1 cut(s) 652
BisI GCNGC 1 cut(s) 87
BlnI CCTAGG 1 cut(s) 707
BlsI GCNGC 1 cut(s) 88
BmcAI AGTACT 1 cut(s) 822
BmsI GCATC 1 cut(s) 473
Bpu10I CCTNAGC 1 cut(s) 474
BsaJI CCNNGG 1 cut(s) 707
BsaWI WCCGGW 1 cut(s) 511
Bsc4I CCNNNNNNNGG 2 cut(s) 329, 529
Bse3DI GCAATG 2 cut(s) 96, 272
BseDI CCNNGG 1 cut(s) 707
BseGI GGATG 5 cut(s) 358, 488, 583, 620, 772
BseLI CCNNNNNNNGG 2 cut(s) 329, 529
BseMI GCAATG 2 cut(s) 96, 272
BseRI GAGGAG 1 cut(s) 727
BshFI GGCC 1 cut(s) 533
BsiSI CCGG 1 cut(s) 512
BslI CCNNNNNNNGG 2 cut(s) 329, 529
BsnI GGCC 1 cut(s) 533
Bsp143I GATC 5 cut(s) 202, 256, 508, 537, 652
BspACI CCGC 1 cut(s) 86
BspANI GGCC 1 cut(s) 533
BspHI TCATGA 1 cut(s) 745
BspPI GGATC 1 cut(s) 503
BsrDI GCAATG 2 cut(s) 96, 272
BssECI CCNNGG 1 cut(s) 707
BssMI GATC 5 cut(s) 202, 256, 508, 537, 652
BssSI CACGAG 1 cut(s) 252
BssT1I CCWWGG 1 cut(s) 707
Bst2BI CACGAG 1 cut(s) 252
Bst6I CTCTTC 2 cut(s) 545, 765
BstC8I GCNNGC 2 cut(s) 63, 286
BstDEI CTNAG 2 cut(s) 474, 700
BstF5I GGATG 5 cut(s) 358, 488, 583, 620, 772
BstKTI GATC 5 cut(s) 205, 259, 511, 540, 655
BstMBI GATC 5 cut(s) 202, 256, 508, 537, 652
BstMWI GCNNNNNNNGC 2 cut(s) 107, 596
BstNSI RCATGY 1 cut(s) 65
BstX2I RGATCY 1 cut(s) 652
BstYI RGATCY 1 cut(s) 652
BsuRI GGCC 1 cut(s) 533
BtsCI GGATG 5 cut(s) 358, 488, 583, 620, 772
Cac8I GCNNGC 2 cut(s) 63, 286
CciI TCATGA 1 cut(s) 745
Csp6I GTAC 2 cut(s) 581, 821
CviAII CATG 3 cut(s) 62, 349, 746
CviQI GTAC 2 cut(s) 581, 821
DdeI CTNAG 2 cut(s) 474, 700
DpnI GATC 5 cut(s) 204, 258, 510, 539, 654
DpnII GATC 5 cut(s) 202, 256, 508, 537, 652
DraI TTTAAA 1 cut(s) 120
Eam1104I CTCTTC 2 cut(s) 545, 765
EarI CTCTTC 2 cut(s) 545, 765
Eco130I CCWWGG 1 cut(s) 707
EcoT14I CCWWGG 1 cut(s) 707
ErhI CCWWGG 1 cut(s) 707
FaeI CATG 3 cut(s) 65, 352, 749
FatI CATG 3 cut(s) 61, 348, 745
FauNDI CATATG 1 cut(s) 313
FbaI TGATCA 1 cut(s) 256
Fnu4HI GCNGC 1 cut(s) 87
FokI GGATG 5 cut(s) 365, 495, 590, 627, 779
Fsp4HI GCNGC 1 cut(s) 87
FspBI CTAG 4 cut(s) 591, 660, 708, 824
GluI GCNGC 1 cut(s) 87
HaeIII GGCC 1 cut(s) 533
HapII CCGG 1 cut(s) 512
Hin1II CATG 3 cut(s) 65, 352, 749
HindIII AAGCTT 1 cut(s) 465
HinfI GANTC 3 cut(s) 647, 680, 803
HpaII CCGG 1 cut(s) 512
HphI GGTGA 3 cut(s) 53, 424, 644
Hpy188I TCNGA 3 cut(s) 652, 766, 808
Hpy188III TCNNGA 7 cut(s) 206, 254, 295, 386, 684, 728, 746
HpyCH4V TGCA 4 cut(s) 65, 277, 430, 486
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 596
HpyF3I CTNAG 2 cut(s) 474, 700
Hsp92II CATG 3 cut(s) 65, 352, 749
Ksp22I TGATCA 1 cut(s) 256
Kzo9I GATC 5 cut(s) 202, 256, 508, 537, 652
LpnPI CCDG 2 cut(s) 525, 532
LweI GCATC 1 cut(s) 473
MaeI CTAG 4 cut(s) 591, 660, 708, 824
MaeIII GTNAC 1 cut(s) 412
MalI GATC 5 cut(s) 204, 258, 510, 539, 654
MboI GATC 5 cut(s) 202, 256, 508, 537, 652
MflI RGATCY 1 cut(s) 652
MluCI AATT 6 cut(s) 406, 425, 502, 524, 732, 845
MlyI GAGTC 2 cut(s) 656, 812
MnlI CCTC 9 cut(s) 302, 367, 670, 705, 742, 766, 808, 820, 844
MseI TTAA 2 cut(s) 119, 180
MslI CAYNNNNRTG 1 cut(s) 613
MspI CCGG 1 cut(s) 512
MwoI GCNNNNNNNGC 2 cut(s) 107, 596
NdeI CATATG 1 cut(s) 313
NdeII GATC 5 cut(s) 202, 256, 508, 537, 652
NlaIII CATG 3 cut(s) 65, 352, 749
NmuCI GTSAC 1 cut(s) 412
NspI RCATGY 1 cut(s) 65
PaeI GCATGC 1 cut(s) 65
PagI TCATGA 1 cut(s) 745
PfeI GAWTC 1 cut(s) 680
PflMI CCANNNNNTGG 1 cut(s) 329
PkrI GCNGC 1 cut(s) 88
PleI GAGTC 2 cut(s) 655, 811
PpsI GAGTC 2 cut(s) 655, 811
PsrI GAACNNNNNNTAC 2 cut(s) 290, 322
PsuI RGATCY 1 cut(s) 652
RsaI GTAC 2 cut(s) 582, 822
RsaNI GTAC 2 cut(s) 581, 821
RseI CAYNNNNRTG 1 cut(s) 613
SaqAI TTAA 2 cut(s) 119, 180
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 5 cut(s) 202, 256, 508, 537, 652
ScaI AGTACT 1 cut(s) 822
SchI GAGTC 2 cut(s) 656, 812
SfaNI GCATC 1 cut(s) 473
SmiMI CAYNNNNRTG 1 cut(s) 613
SpeI ACTAGT 1 cut(s) 659
SphI GCATGC 1 cut(s) 65
Sse9I AATT 6 cut(s) 406, 425, 502, 524, 732, 845
SsiI CCGC 1 cut(s) 86
SspMI CTAG 4 cut(s) 591, 660, 708, 824
StyI CCWWGG 1 cut(s) 707
TasI AATT 6 cut(s) 406, 425, 502, 524, 732, 845
TatI WGTACW 2 cut(s) 580, 820
TauI GCSGC 1 cut(s) 89
TfiI GAWTC 1 cut(s) 680
Tru1I TTAA 2 cut(s) 119, 180
Tru9I TTAA 2 cut(s) 119, 180
TseFI GTSAC 1 cut(s) 412
Tsp45I GTSAC 1 cut(s) 412
TspDTI ATGAA 7 cut(s) 66, 107, 261, 575, 651, 734, 783
Van91I CCANNNNNTGG 1 cut(s) 329
XapI RAATTY 2 cut(s) 406, 845
XceI RCATGY 1 cut(s) 65
XmaJI CCTAGG 1 cut(s) 707
XspI CTAG 4 cut(s) 591, 660, 708, 824
ZrmI AGTACT 1 cut(s) 822
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.