Rmu_sc0023788.1_g000001

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023788.1
OG0000698
Physical Location & Seq
Reverse (-)
2357 .. 3646
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023788.1_g000001.1.cds

Sequence Viewer

Length: 510 bp
atggaatgcaagcgcaaagagtgtaaaggggaagacggcggtgaatattgtagtgtaaaggggaagacggcggtgaatattgctttgagtgcttctttttggaatgggatccatacaaagaaaaggaatagactagatacaacgaggttaaacaatttagtctatgtccaattcaatgccaagattctcaacaagaagagaagaatgaaagagaggaatgtggatgtattactagcatgtgaagctactatggcccaaggatggattgtggatggtggtgatgaagatgtagattccgatcttactagtgatgtagttggagagggatcgggattgggagtggatagtagcttagagcctaggagaagtagtagaattcaagaaattagagaacttcatgaggatgattttgtatcggatgaagaggaagaagatgagatgacttttgagtttgactccgatgaggagggagtactagagggatatggagaagaagaatttgaggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT

Protein Analysis

169

Amino Acids

19.11

Weight (kDa)

4.44

Isoelectric Point (pI)

58.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000698)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G43260 AT5G31412
fragaria_vesca FvH4_2g24751 FvH4_3g29751 FvH4_3g29752 FvH4_3g32705 FvH4_4g20841 FvH4_5g39742 FvH4_6g06672 FvH4_6g28272 FvH4_6g28273 FvH4_7g00215
malus_domestica MD07G1147000.v1.1
prunus_persica Prupe.4G255800_v2.0.a1
pyrus_communis pycom09g15950 pycom10g13140
rosa_chinensis RchiOBHm_Chr1g0314441 RchiOBHm_Chr1g0314451 RchiOBHm_Chr4g0430441 RchiOBHm_Chr4g0430831 RchiOBHm_Chr5g0003001 RchiOBHm_Chr5g0033441 RchiOBHm_Chr6g0251571 RchiOBHm_Chr6g0288501
rosa_multiflora Rmu_co8007098.1_g000001 Rmu_co8211970.1_g000002 Rmu_sc0000146.1_g000031 Rmu_sc0000555.1_g000022 Rmu_sc0000968.1_g000005 Rmu_sc0001017.1_g000028 Rmu_sc0001208.1_g000044 Rmu_sc0001526.1_g000038 Rmu_sc0002226.1_g000026 Rmu_sc0002284.1_g000006 Rmu_sc0002776.1_g000004 Rmu_sc0003369.1_g000011 Rmu_sc0003632.1_g000005 Rmu_sc0004180.1_g000007 Rmu_sc0004180.1_g000008 Rmu_sc0005014.1_g000005 Rmu_sc0005023.1_g000011 Rmu_sc0007296.1_g000009 Rmu_sc0011153.1_g000002 Rmu_sc0011153.1_g000003 Rmu_sc0018472.1_g000003 Rmu_sc0020646.1_g000001 Rmu_sc0022773.1_g000001 Rmu_sc0022773.1_g000002 Rmu_sc0023555.1_g000001 Rmu_sc0023788.1_g000001 Rmu_ssc0000409.1_g000026 Rmu_ssc0000421.1_g000039
rosa_roxburghii Rroxscaffold_2G00091530 Rroxscaffold_5G00355490 Rroxscaffold_6G00405690 Rroxscaffold_6G00412290 Rroxscaffold_7G00195870
rosa_rugosa Rorug05G0244000
rosa_samantha Rh3DG075100
rosa_wichuraiana Rw0G014340 Rw1G023020 Rw2G020120 Rw2G033790 Rw2G035670 Rw3G022290 Rw3G023070 Rw3G023080 Rw4G003460 Rw4G017840 Rw4G032430 Rw5G024280 Rw5G044440 Rw6G027410 Rw7G020330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 39, 71
AclWI GGATC 3 cut(s) 103, 116, 334
AcsI RAATTY 2 cut(s) 375, 497
AfaI GTAC 1 cut(s) 474
AfiI CCNNNNNNNGG 1 cut(s) 261
AgsI TTSAA 2 cut(s) 175, 380
AhlI ACTAGT 1 cut(s) 305
AluBI AGCT 2 cut(s) 245, 351
AluI AGCT 2 cut(s) 245, 351
AlwI GGATC 3 cut(s) 103, 116, 334
AoxI GGCC 1 cut(s) 252
ApoI RAATTY 2 cut(s) 375, 497
AspA2I CCTAGG 1 cut(s) 359
AspLEI GCGC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 253
AsuHPI GGTGA 3 cut(s) 53, 85, 290
AvrII CCTAGG 1 cut(s) 359
BamHI GGATCC 1 cut(s) 108
BbsI GAAGAC 2 cut(s) 39, 71
BccI CCATC 2 cut(s) 255, 266
BceAI ACGGC 2 cut(s) 52, 84
BcuI ACTAGT 1 cut(s) 305
BfaI CTAG 5 cut(s) 134, 233, 306, 360, 476
BlnI CCTAGG 1 cut(s) 359
BmcAI AGTACT 1 cut(s) 474
BmgT120I GGNCC 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 110
BpiI GAAGAC 2 cut(s) 39, 71
BplI GAGNNNNNCTC 2 cut(s) 440, 472
BsaBI GATNNNNATC 1 cut(s) 297
BsaJI CCNNGG 2 cut(s) 256, 359
BsaXI ACNNNNNCTCC 2 cut(s) 355, 385
Bsc4I CCNNNNNNNGG 1 cut(s) 261
Bse8I GATNNNNATC 1 cut(s) 297
BseDI CCNNGG 2 cut(s) 256, 359
BseGI GGATG 5 cut(s) 229, 266, 277, 409, 424
BseJI GATNNNNATC 1 cut(s) 297
BseLI CCNNNNNNNGG 1 cut(s) 261
BseRI GAGGAG 1 cut(s) 479
BshFI GGCC 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 261
BsmI GAATGC 1 cut(s) 11
BsnI GGCC 1 cut(s) 254
Bsp143I GATC 3 cut(s) 108, 298, 326
BspACI CCGC 2 cut(s) 39, 71
BspANI GGCC 1 cut(s) 254
BspHI TCATGA 1 cut(s) 397
BspLI GGNNCC 1 cut(s) 110
BspPI GGATC 3 cut(s) 103, 116, 334
BssECI CCNNGG 2 cut(s) 256, 359
BssMI GATC 3 cut(s) 108, 298, 326
BssT1I CCWWGG 2 cut(s) 256, 359
Bst6I CTCTTC 2 cut(s) 191, 417
BstC8I GCNNGC 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 352
BstF5I GGATG 5 cut(s) 229, 266, 277, 409, 424
BstHHI GCGC 1 cut(s) 15
BstKTI GATC 3 cut(s) 111, 301, 329
BstMBI GATC 3 cut(s) 108, 298, 326
BstMWI GCNNNNNNNGC 3 cut(s) 89, 242, 251
BstNSI RCATGY 1 cut(s) 240
BstV2I GAAGAC 2 cut(s) 39, 71
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BsuRI GGCC 1 cut(s) 254
BtsCI GGATG 5 cut(s) 229, 266, 277, 409, 424
Cac8I GCNNGC 1 cut(s) 11
CciI TCATGA 1 cut(s) 397
CfoI GCGC 1 cut(s) 15
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 473
CviAII CATG 2 cut(s) 237, 398
CviJI RGCY 4 cut(s) 245, 254, 351, 358
CviKI_1 RGCY 4 cut(s) 245, 254, 351, 358
CviQI GTAC 1 cut(s) 473
DdeI CTNAG 1 cut(s) 352
DpnI GATC 3 cut(s) 110, 300, 328
DpnII GATC 3 cut(s) 108, 298, 326
Eam1104I CTCTTC 2 cut(s) 191, 417
EarI CTCTTC 2 cut(s) 191, 417
Eco130I CCWWGG 2 cut(s) 256, 359
EcoRI GAATTC 1 cut(s) 375
EcoT14I CCWWGG 2 cut(s) 256, 359
ErhI CCWWGG 2 cut(s) 256, 359
FaeI CATG 2 cut(s) 240, 401
FaiI YATR 6 cut(s) 114, 165, 238, 251, 399, 486
FatI CATG 2 cut(s) 236, 397
FokI GGATG 5 cut(s) 236, 273, 284, 416, 431
FspBI CTAG 5 cut(s) 134, 233, 306, 360, 476
GlaI GCGC 1 cut(s) 14
HaeIII GGCC 1 cut(s) 254
HhaI GCGC 1 cut(s) 15
Hin1II CATG 2 cut(s) 240, 401
Hin6I GCGC 1 cut(s) 13
HinP1I GCGC 1 cut(s) 13
HinfI GANTC 3 cut(s) 184, 293, 455
HphI GGTGA 3 cut(s) 53, 85, 290
Hpy188I TCNGA 3 cut(s) 298, 418, 460
Hpy188III TCNNGA 3 cut(s) 330, 380, 398
HpyCH4V TGCA 1 cut(s) 9
HpyF10VI GCNNNNNNNGC 3 cut(s) 89, 242, 251
HpyF3I CTNAG 1 cut(s) 352
Hsp92II CATG 2 cut(s) 240, 401
HspAI GCGC 1 cut(s) 13
Kzo9I GATC 3 cut(s) 108, 298, 326
MaeI CTAG 5 cut(s) 134, 233, 306, 360, 476
MalI GATC 3 cut(s) 110, 300, 328
MboI GATC 3 cut(s) 108, 298, 326
MflI RGATCY 1 cut(s) 108
MluCI AATT 5 cut(s) 154, 170, 375, 384, 497
MlyI GAGTC 1 cut(s) 449
MmeI TCCRAC 1 cut(s) 298
MnlI CCTC 9 cut(s) 138, 207, 316, 394, 418, 457, 460, 472, 496
MseI TTAA 1 cut(s) 149
MslI CAYNNNNRTG 1 cut(s) 402
Mva1269I GAATGC 1 cut(s) 11
MwoI GCNNNNNNNGC 3 cut(s) 89, 242, 251
NdeII GATC 3 cut(s) 108, 298, 326
NlaIII CATG 2 cut(s) 240, 401
NlaIV GGNNCC 1 cut(s) 110
NspI RCATGY 1 cut(s) 240
PagI TCATGA 1 cut(s) 397
PctI GAATGC 1 cut(s) 11
PfeI GAWTC 2 cut(s) 184, 293
PleI GAGTC 1 cut(s) 449
PpsI GAGTC 1 cut(s) 449
PspN4I GGNNCC 1 cut(s) 110
PspPI GGNCC 1 cut(s) 253
PsuI RGATCY 1 cut(s) 108
RsaI GTAC 1 cut(s) 474
RsaNI GTAC 1 cut(s) 473
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 149
Sau3AI GATC 3 cut(s) 108, 298, 326
Sau96I GGNCC 1 cut(s) 253
ScaI AGTACT 1 cut(s) 474
SchI GAGTC 1 cut(s) 449
SetI ASST 3 cut(s) 149, 247, 353
SmiMI CAYNNNNRTG 1 cut(s) 402
SpeI ACTAGT 1 cut(s) 305
Sse9I AATT 5 cut(s) 154, 170, 375, 384, 497
SsiI CCGC 2 cut(s) 39, 71
SspI AATATT 2 cut(s) 47, 79
SspMI CTAG 5 cut(s) 134, 233, 306, 360, 476
StyI CCWWGG 2 cut(s) 256, 359
TasI AATT 5 cut(s) 154, 170, 375, 384, 497
TatI WGTACW 1 cut(s) 472
TfiI GAWTC 2 cut(s) 184, 293
Tru1I TTAA 1 cut(s) 149
Tru9I TTAA 1 cut(s) 149
TspDTI ATGAA 4 cut(s) 221, 297, 386, 435
XapI RAATTY 2 cut(s) 375, 497
XceI RCATGY 1 cut(s) 240
XmaJI CCTAGG 1 cut(s) 359
XspI CTAG 5 cut(s) 134, 233, 306, 360, 476
ZrmI AGTACT 1 cut(s) 474
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.