Rmu_sc0002145.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002145.1
OG0000167
Physical Location & Seq
Forward (+)
16454 .. 21079
4626 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002145.1_g000003.1.cds

Sequence Viewer

Length: 384 bp
atgcgaaatacaaatgagcacgaggaattgcaagtggttgctgttatatatctcgtccggctgttaaaagtgttcatctacgaaaattgggacgtatttgtagagcacatctgtggggatgtcgtagaagatgaattgatcctggaaaatgttaaggacgatgacgatgaagccggctatgcaactgaaggtgaagtcgcagttcaggtcagggccgtcaggccactgaatgtggattttgagctcgatggaatcgacgaaagaggatctcgatggaatcgacgacataggtttggaattgacggcgcaggtctggaattgtgtcaatcgacgaaagaggagctcgacggcgcaaccacgctaggcggtgaatgtggtgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.35

Weight (kDa)

4.31

Isoelectric Point (pI)

35.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G37980 AT4G37980 AT4G37990
fragaria_vesca FvH4_1g19210 FvH4_1g19220 FvH4_1g19240 FvH4_1g19240 FvH4_1g19261 FvH4_1g19262 FvH4_1g19263 FvH4_1g19263 FvH4_1g19265 FvH4_1g19281 FvH4_1g19281 FvH4_7g07240 FvH4_7g07240 FvH4_7g07240
malus_domestica MD01G1042500.v1.1 MD01G1042600.v1.1 MD01G1042800.v1.1 MD01G1042900.v1.1 MD05G1034100.v1.1 MD10G1035900.v1.1 MD10G1036000.v1.1 MD10G1155000.v1.1 MD10G1155100.v1.1 MD10G1155200.v1.1 MD10G1155400.v1.1 MD10G1155700.v1.1 MD10G1155800.v1.1 MD15G1308800.v1.1 MD15G1308900.v1.1
prunus_persica Prupe.6G205600_v2.0.a1 Prupe.6G205700_v2.0.a1 Prupe.6G205800_v2.0.a1 Prupe.6G205900_v2.0.a1 Prupe.6G206300_v2.0.a1 Prupe.6G206800_v2.0.a1 Prupe.6G207100_v2.0.a1 Prupe.6G207200_v2.0.a1 Prupe.6G207300_v2.0.a1 Prupe.6G207400_v2.0.a1 Prupe.6G207500_v2.0.a1 Prupe.6G207600_v2.0.a1 Prupe.6G207700_v2.0.a1 Prupe.6G207900_v2.0.a1
pyrus_communis pycom01g06970 pycom01g06980 pycom01g06990 pycom05g02460 pycom08g00750 pycom10g13410 pycom15g27310 pycom15g27320
rosa_chinensis RchiOBHm_Chr1g0314861 RchiOBHm_Chr1g0345441 RchiOBHm_Chr1g0345451 RchiOBHm_Chr1g0345621 RchiOBHm_Chr1g0345751 RchiOBHm_Chr1g0345861 RchiOBHm_Chr1g0345871 RchiOBHm_Chr1g0345891 RchiOBHm_Chr2g0094851 RchiOBHm_Chr2g0110471 RchiOBHm_Chr2g0110511 RchiOBHm_Chr2g0110531 RchiOBHm_Chr2g0110541 RchiOBHm_Chr2g0110571 RchiOBHm_Chr5g0039381 RchiOBHm_Chr5g0039391 RchiOBHm_Chr6g0270311 RchiOBHm_Chr6g0270331 RchiOBHm_Chr6g0270411 RchiOBHm_Chr6g0270431
rosa_laevigata RLG00000000515 RLG00000013793 RLG00000013797 RLG00000013799 RLG00000016525 RLG00000017808 RLG00000017811 RLG00000017813 RLG00000017816 RLG00000017819 RLG00000017822 RLG00000017824 RLG00000017825 RLG00000028835
rosa_multiflora Rmu_co8225458.1_g000001 Rmu_sc0000389.1_g000006 Rmu_sc0000389.1_g000014 Rmu_sc0000389.1_g000023 Rmu_sc0001292.1_g000012 Rmu_sc0001292.1_g000026 Rmu_sc0002145.1_g000003 Rmu_sc0002329.1_g000033 Rmu_sc0002833.1_g000044 Rmu_sc0004316.1_g000012 Rmu_sc0004439.1_g000003 Rmu_sc0006422.1_g000028 Rmu_sc0009479.1_g000012 Rmu_sc0010489.1_g000009 Rmu_sc0010489.1_g000010 Rmu_sc0017837.1_g000003 Rmu_sc0032320.1_g000001
rosa_roxburghii Rroxscaffold_1G00050770 Rroxscaffold_2G00133110 Rroxscaffold_2G00133140 Rroxscaffold_2G00133200 Rroxscaffold_2G00133270 Rroxscaffold_2G00133290 Rroxscaffold_2G00133300 Rroxscaffold_2G00133350 Rroxscaffold_4G00292490 Rroxscaffold_4G00309020 Rroxscaffold_4G00331740 Rroxscaffold_4G00331800 Rroxscaffold_6G00404470 Rroxscaffold_7G00197950 Rroxscaffold_7G00197990 Rroxscaffold_7G00198020
rosa_rugosa Rorug01G0002500 Rorug02G0047200 Rorug02G0047300 Rorug02G0047300 Rorug02G0047400 Rorug02G0168000 Rorug02G0168000 Rorug02G0168100 Rorug02G0168100 Rorug02G0168400.1 Rorug03G0157600 Rorug03G0157700 Rorug05G0112600 Rorug06G0054600 Rorug06G0054700
rosa_samantha Rh1AG013300 Rh1AG195600 Rh1AG195700 Rh1AG196000 Rh1BG004900 Rh1BG114300 Rh2AG132300 Rh2BG095500 Rh2BG229700 Rh2BG229800 Rh2CG097400 Rh2CG221500 Rh2CG221800 Rh2CG222100 Rh2CG222200 Rh2CG222500 Rh2CG222600 Rh2CG345000 Rh5BG269700 Rh6AG172900 Rh6AG173100 Rh6CG080500 Rh6DG075900 Rh6DG164700 Rh6DG164900 Rh6DG165200 Rh6DG165300
rosa_wichuraiana Rw0G015390 Rw1G000600 Rw1G016130 Rw1G016190 Rw2G007140 Rw2G016970 Rw2G016990 Rw2G017000 Rw3G018910 Rw3G018920 Rw3G018930 Rw5G024830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 299
AciI CCGC 1 cut(s) 366
AclWI GGATC 2 cut(s) 133, 274
AcuI CTGAAG 1 cut(s) 207
AjnI CCWGG 1 cut(s) 141
AleI CACNNNNGTG 1 cut(s) 111
AluBI AGCT 2 cut(s) 244, 343
AluI AGCT 2 cut(s) 244, 343
Alw21I GWGCWC 4 cut(s) 21, 108, 246, 345
AlwI GGATC 2 cut(s) 133, 274
AoxI GGCC 2 cut(s) 213, 221
AspLEI GCGC 2 cut(s) 308, 353
AspS9I GGNCC 1 cut(s) 213
AsuHPI GGTGA 2 cut(s) 203, 380
BanII GRGCYC 2 cut(s) 246, 345
BauI CACGAG 1 cut(s) 20
Bbv12I GWGCWC 4 cut(s) 21, 108, 246, 345
BccI CCATC 2 cut(s) 242, 267
BceAI ACGGC 3 cut(s) 200, 319, 364
BciT130I CCWGG 1 cut(s) 143
BfaI CTAG 1 cut(s) 362
BfuAI ACCTGC 1 cut(s) 299
Bme1390I CCNGG 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 213
BmrFI CCNGG 1 cut(s) 143
Bse118I RCCGGY 1 cut(s) 173
BseBI CCWGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 124
BseRI GAGGAG 1 cut(s) 353
BshFI GGCC 2 cut(s) 215, 223
BsiHKAI GWGCWC 4 cut(s) 21, 108, 246, 345
BsiSI CCGG 2 cut(s) 58, 174
BslFI GGGAC 1 cut(s) 104
BsmFI GGGAC 1 cut(s) 104
BsnI GGCC 2 cut(s) 215, 223
Bsp1286I GDGCHC 4 cut(s) 21, 108, 246, 345
Bsp143I GATC 2 cut(s) 138, 266
BspACI CCGC 1 cut(s) 366
BspANI GGCC 2 cut(s) 215, 223
BspMI ACCTGC 1 cut(s) 299
BspPI GGATC 2 cut(s) 133, 274
BsrFI RCCGGY 1 cut(s) 173
BssAI RCCGGY 1 cut(s) 173
BssMI GATC 2 cut(s) 138, 266
BssSI CACGAG 1 cut(s) 20
Bst2BI CACGAG 1 cut(s) 20
Bst2UI CCWGG 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 175
BstF5I GGATG 1 cut(s) 124
BstHHI GCGC 2 cut(s) 308, 353
BstKTI GATC 2 cut(s) 141, 269
BstMBI GATC 2 cut(s) 138, 266
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstX2I RGATCY 1 cut(s) 266
BstYI RGATCY 1 cut(s) 266
BsuRI GGCC 2 cut(s) 215, 223
BtsCI GGATG 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 224
BveI ACCTGC 1 cut(s) 299
Cac8I GCNNGC 1 cut(s) 175
CfoI GCGC 2 cut(s) 308, 353
Cfr10I RCCGGY 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 213
CviJI RGCY 7 cut(s) 61, 173, 177, 215, 223, 244, 343
CviKI_1 RGCY 7 cut(s) 61, 173, 177, 215, 223, 244, 343
DpnI GATC 2 cut(s) 140, 268
DpnII GATC 2 cut(s) 138, 266
Ecl136II GAGCTC 2 cut(s) 244, 343
Eco24I GRGCYC 2 cut(s) 246, 345
Eco53kI GAGCTC 2 cut(s) 244, 343
Eco57I CTGAAG 1 cut(s) 207
EcoICRI GAGCTC 2 cut(s) 244, 343
EcoRII CCWGG 1 cut(s) 141
EcoT38I GRGCYC 2 cut(s) 246, 345
FaiI YATR 4 cut(s) 47, 49, 180, 288
FaqI GGGAC 1 cut(s) 104
FokI GGATG 1 cut(s) 131
FriOI GRGCYC 2 cut(s) 246, 345
FspBI CTAG 1 cut(s) 362
GlaI GCGC 2 cut(s) 307, 352
HaeIII GGCC 2 cut(s) 215, 223
HapII CCGG 2 cut(s) 58, 174
HhaI GCGC 2 cut(s) 308, 353
Hin6I GCGC 2 cut(s) 306, 351
HinP1I GCGC 2 cut(s) 306, 351
HinfI GANTC 2 cut(s) 252, 277
HpaII CCGG 2 cut(s) 58, 174
HphI GGTGA 2 cut(s) 203, 380
Hpy188III TCNNGA 2 cut(s) 270, 314
Hpy99I CGWCG 4 cut(s) 260, 285, 334, 350
HpyAV CCTTC 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 2 cut(s) 31, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
HpySE526I ACGT 1 cut(s) 93
HspAI GCGC 2 cut(s) 306, 351
KroI GCCGGC 1 cut(s) 173
KroNI GCCGGC 1 cut(s) 175
Kzo9I GATC 2 cut(s) 138, 266
LmnI GCTCC 1 cut(s) 340
LpnPI CCDG 9 cut(s) 71, 128, 155, 187, 191, 196, 205, 294, 299
MaeI CTAG 1 cut(s) 362
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 377
MalI GATC 2 cut(s) 140, 268
MboI GATC 2 cut(s) 138, 266
MboII GAAGA 1 cut(s) 140
MflI RGATCY 1 cut(s) 266
MhlI GDGCHC 4 cut(s) 21, 108, 246, 345
MluCI AATT 5 cut(s) 26, 85, 134, 297, 317
MnlI CCTC 3 cut(s) 16, 257, 331
MroNI GCCGGC 1 cut(s) 173
MseI TTAA 2 cut(s) 65, 153
MslI CAYNNNNRTG 1 cut(s) 111
MspI CCGG 2 cut(s) 58, 174
MspR9I CCNGG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 179
NaeI GCCGGC 1 cut(s) 175
NdeII GATC 2 cut(s) 138, 266
NgoMIV GCCGGC 1 cut(s) 173
NmuCI GTSAC 1 cut(s) 377
OliI CACNNNNGTG 1 cut(s) 111
PcsI WCGNNNNNNNCGW 2 cut(s) 252, 277
PdiI GCCGGC 1 cut(s) 175
PfeI GAWTC 2 cut(s) 252, 277
PfoI TCCNGGA 1 cut(s) 141
Psp124BI GAGCTC 2 cut(s) 246, 345
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PspPI GGNCC 1 cut(s) 213
PsuI RGATCY 1 cut(s) 266
RseI CAYNNNNRTG 1 cut(s) 111
SacI GAGCTC 2 cut(s) 246, 345
SaqAI TTAA 2 cut(s) 65, 153
Sau3AI GATC 2 cut(s) 138, 266
Sau96I GGNCC 1 cut(s) 213
ScrFI CCNGG 1 cut(s) 143
SduI GDGCHC 4 cut(s) 21, 108, 246, 345
SetI ASST 7 cut(s) 96, 193, 210, 246, 293, 313, 345
SmiMI CAYNNNNRTG 1 cut(s) 111
Sse9I AATT 5 cut(s) 26, 85, 134, 297, 317
SsiI CCGC 1 cut(s) 366
SspMI CTAG 1 cut(s) 362
SstI GAGCTC 2 cut(s) 246, 345
StyD4I CCNGG 1 cut(s) 141
TaiI ACGT 1 cut(s) 96
TaqI TCGA 6 cut(s) 246, 255, 271, 280, 329, 345
TasI AATT 5 cut(s) 26, 85, 134, 297, 317
TfiI GAWTC 2 cut(s) 252, 277
Tru1I TTAA 2 cut(s) 65, 153
Tru9I TTAA 2 cut(s) 65, 153
TscAI CASTG 1 cut(s) 231
TseFI GTSAC 1 cut(s) 377
Tsp45I GTSAC 1 cut(s) 377
TspDTI ATGAA 3 cut(s) 64, 147, 183
TspRI CASTG 1 cut(s) 231
XspI CTAG 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.