Rroxscaffold_4G00292490

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
12782027 .. 12782302
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00292490.1

Sequence Viewer

Length: 276 bp
ATGCCATCTCCGTCGAGATCGGTCATGTTGGAACCTATTCTCTCGACGACTAGATCGATGCTTCGAATAGTCTCTCTCAAGACGGAACTTGCTCTTTCTAGGAACGTATTTGTAAAGTGCATCTGTGGGGATGTTGTAGAAGATGAATTGATCTTGGAAAATGTTGAGGATGATGACGATGAAGCCGGCTATGCAACTAAAGGTGAAGTCATTGGTCCAAAAGCAGTGGGAGGAGGTGAAGAGGAAGCGGAGAGTGAAAGATTAGAGAATGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

9.84

Weight (kDa)

4.26

Isoelectric Point (pI)

62.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G37980 AT4G37980 AT4G37990
fragaria_vesca FvH4_1g19210 FvH4_1g19220 FvH4_1g19240 FvH4_1g19240 FvH4_1g19261 FvH4_1g19262 FvH4_1g19263 FvH4_1g19263 FvH4_1g19265 FvH4_1g19281 FvH4_1g19281 FvH4_7g07240 FvH4_7g07240 FvH4_7g07240
malus_domestica MD01G1042500.v1.1 MD01G1042600.v1.1 MD01G1042800.v1.1 MD01G1042900.v1.1 MD05G1034100.v1.1 MD10G1035900.v1.1 MD10G1036000.v1.1 MD10G1155000.v1.1 MD10G1155100.v1.1 MD10G1155200.v1.1 MD10G1155400.v1.1 MD10G1155700.v1.1 MD10G1155800.v1.1 MD15G1308800.v1.1 MD15G1308900.v1.1
prunus_persica Prupe.6G205600_v2.0.a1 Prupe.6G205700_v2.0.a1 Prupe.6G205800_v2.0.a1 Prupe.6G205900_v2.0.a1 Prupe.6G206300_v2.0.a1 Prupe.6G206800_v2.0.a1 Prupe.6G207100_v2.0.a1 Prupe.6G207200_v2.0.a1 Prupe.6G207300_v2.0.a1 Prupe.6G207400_v2.0.a1 Prupe.6G207500_v2.0.a1 Prupe.6G207600_v2.0.a1 Prupe.6G207700_v2.0.a1 Prupe.6G207900_v2.0.a1
pyrus_communis pycom01g06970 pycom01g06980 pycom01g06990 pycom05g02460 pycom08g00750 pycom10g13410 pycom15g27310 pycom15g27320
rosa_chinensis RchiOBHm_Chr1g0314861 RchiOBHm_Chr1g0345441 RchiOBHm_Chr1g0345451 RchiOBHm_Chr1g0345621 RchiOBHm_Chr1g0345751 RchiOBHm_Chr1g0345861 RchiOBHm_Chr1g0345871 RchiOBHm_Chr1g0345891 RchiOBHm_Chr2g0094851 RchiOBHm_Chr2g0110471 RchiOBHm_Chr2g0110511 RchiOBHm_Chr2g0110531 RchiOBHm_Chr2g0110541 RchiOBHm_Chr2g0110571 RchiOBHm_Chr5g0039381 RchiOBHm_Chr5g0039391 RchiOBHm_Chr6g0270311 RchiOBHm_Chr6g0270331 RchiOBHm_Chr6g0270411 RchiOBHm_Chr6g0270431
rosa_laevigata RLG00000000515 RLG00000013793 RLG00000013797 RLG00000013799 RLG00000016525 RLG00000017808 RLG00000017811 RLG00000017813 RLG00000017816 RLG00000017819 RLG00000017822 RLG00000017824 RLG00000017825 RLG00000028835
rosa_multiflora Rmu_co8225458.1_g000001 Rmu_sc0000389.1_g000006 Rmu_sc0000389.1_g000014 Rmu_sc0000389.1_g000023 Rmu_sc0001292.1_g000012 Rmu_sc0001292.1_g000026 Rmu_sc0002145.1_g000003 Rmu_sc0002329.1_g000033 Rmu_sc0002833.1_g000044 Rmu_sc0004316.1_g000012 Rmu_sc0004439.1_g000003 Rmu_sc0006422.1_g000028 Rmu_sc0009479.1_g000012 Rmu_sc0010489.1_g000009 Rmu_sc0010489.1_g000010 Rmu_sc0017837.1_g000003 Rmu_sc0032320.1_g000001
rosa_roxburghii Rroxscaffold_1G00050770 Rroxscaffold_2G00133110 Rroxscaffold_2G00133140 Rroxscaffold_2G00133200 Rroxscaffold_2G00133270 Rroxscaffold_2G00133290 Rroxscaffold_2G00133300 Rroxscaffold_2G00133350 Rroxscaffold_4G00292490 Rroxscaffold_4G00309020 Rroxscaffold_4G00331740 Rroxscaffold_4G00331800 Rroxscaffold_6G00404470 Rroxscaffold_7G00197950 Rroxscaffold_7G00197990 Rroxscaffold_7G00198020
rosa_rugosa Rorug01G0002500 Rorug02G0047200 Rorug02G0047300 Rorug02G0047300 Rorug02G0047400 Rorug02G0168000 Rorug02G0168000 Rorug02G0168100 Rorug02G0168100 Rorug02G0168400.1 Rorug03G0157600 Rorug03G0157700 Rorug05G0112600 Rorug06G0054600 Rorug06G0054700
rosa_samantha Rh1AG013300 Rh1AG195600 Rh1AG195700 Rh1AG196000 Rh1BG004900 Rh1BG114300 Rh2AG132300 Rh2BG095500 Rh2BG229700 Rh2BG229800 Rh2CG097400 Rh2CG221500 Rh2CG221800 Rh2CG222100 Rh2CG222200 Rh2CG222500 Rh2CG222600 Rh2CG345000 Rh5BG269700 Rh6AG172900 Rh6AG173100 Rh6CG080500 Rh6DG075900 Rh6DG164700 Rh6DG164900 Rh6DG165200 Rh6DG165300
rosa_wichuraiana Rw0G015390 Rw1G000600 Rw1G016130 Rw1G016190 Rw2G007140 Rw2G016970 Rw2G016990 Rw2G017000 Rw3G018910 Rw3G018920 Rw3G018930 Rw5G024830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 248
Alw26I GTCTC 1 cut(s) 76
Asp700I GAANNNNTTC 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 215, 248
AsuII TTCGAA 1 cut(s) 64
AvaII GGWCC 1 cut(s) 215
BccI CCATC 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 76
BfaI CTAG 2 cut(s) 51, 99
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 33
BmsI GCATC 2 cut(s) 48, 129
Bpu14I TTCGAA 1 cut(s) 64
BpuEI CTTGAG 1 cut(s) 62
Bsa29I ATCGAT 1 cut(s) 56
Bse118I RCCGGY 1 cut(s) 185
BseCI ATCGAT 1 cut(s) 56
BseGI GGATG 2 cut(s) 136, 175
BseRI GAGGAG 1 cut(s) 246
BshVI ATCGAT 1 cut(s) 56
BsiSI CCGG 1 cut(s) 186
BsmAI GTCTC 1 cut(s) 76
Bsp119I TTCGAA 1 cut(s) 64
Bsp143I GATC 3 cut(s) 17, 53, 150
BspACI CCGC 1 cut(s) 248
BspDI ATCGAT 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 33
BspT104I TTCGAA 1 cut(s) 64
BsrFI RCCGGY 1 cut(s) 185
BssAI RCCGGY 1 cut(s) 185
BssMI GATC 3 cut(s) 17, 53, 150
Bst6I CTCTTC 1 cut(s) 234
BstBI TTCGAA 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 187
BstF5I GGATG 2 cut(s) 136, 175
BstKTI GATC 3 cut(s) 20, 56, 153
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 3 cut(s) 17, 53, 150
BstMWI GCNNNNNNNGC 1 cut(s) 191
Bsu15I ATCGAT 1 cut(s) 56
BsuTUI ATCGAT 1 cut(s) 56
BtsCI GGATG 2 cut(s) 136, 175
BtsI GCAGTG 1 cut(s) 231
BtsIMutI CAGTG 1 cut(s) 231
Cac8I GCNNGC 1 cut(s) 187
Cfr10I RCCGGY 1 cut(s) 185
Cfr13I GGNCC 1 cut(s) 215
ClaI ATCGAT 1 cut(s) 56
CspCI CAANNNNNGTGG 2 cut(s) 207, 242
CviAII CATG 1 cut(s) 25
CviJI RGCY 2 cut(s) 185, 189
CviKI_1 RGCY 2 cut(s) 185, 189
DpnI GATC 3 cut(s) 19, 55, 152
DpnII GATC 3 cut(s) 17, 53, 150
Eam1104I CTCTTC 1 cut(s) 234
EarI CTCTTC 1 cut(s) 234
Eco47I GGWCC 1 cut(s) 215
FaeI CATG 1 cut(s) 28
FaiI YATR 2 cut(s) 26, 192
FatI CATG 1 cut(s) 24
FokI GGATG 2 cut(s) 143, 182
FspBI CTAG 2 cut(s) 51, 99
HapII CCGG 1 cut(s) 186
Hin1II CATG 1 cut(s) 28
HpaII CCGG 1 cut(s) 186
HphI GGTGA 2 cut(s) 215, 248
Hpy188III TCNNGA 3 cut(s) 15, 43, 79
Hpy99I CGWCG 2 cut(s) 16, 49
HpyCH4IV ACGT 1 cut(s) 105
HpyCH4V TGCA 2 cut(s) 120, 194
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpySE526I ACGT 1 cut(s) 105
Hsp92II CATG 1 cut(s) 28
KroI GCCGGC 1 cut(s) 185
KroNI GCCGGC 1 cut(s) 187
Kzo9I GATC 3 cut(s) 17, 53, 150
LpnPI CCDG 1 cut(s) 199
LweI GCATC 2 cut(s) 48, 129
MaeI CTAG 2 cut(s) 51, 99
MaeII ACGT 1 cut(s) 105
MalI GATC 3 cut(s) 19, 55, 152
MboI GATC 3 cut(s) 17, 53, 150
MboII GAAGA 2 cut(s) 152, 251
MluCI AATT 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 9
MnlI CCTC 4 cut(s) 160, 224, 227, 235
MroNI GCCGGC 1 cut(s) 185
MroXI GAANNNNTTC 1 cut(s) 36
MspI CCGG 1 cut(s) 186
MwoI GCNNNNNNNGC 1 cut(s) 191
NaeI GCCGGC 1 cut(s) 187
NdeII GATC 3 cut(s) 17, 53, 150
NgoMIV GCCGGC 1 cut(s) 185
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 1 cut(s) 33
NspV TTCGAA 1 cut(s) 64
PcsI WCGNNNNNNNCGW 1 cut(s) 53
PdiI GCCGGC 1 cut(s) 187
PdmI GAANNNNTTC 1 cut(s) 36
PspN4I GGNNCC 1 cut(s) 33
PspPI GGNCC 1 cut(s) 215
Sau3AI GATC 3 cut(s) 17, 53, 150
Sau96I GGNCC 1 cut(s) 215
SetI ASST 4 cut(s) 37, 108, 205, 238
SfaNI GCATC 2 cut(s) 48, 129
SfuI TTCGAA 1 cut(s) 64
SgeI CNNG 9 cut(s) 27, 37, 55, 63, 91, 101, 111, 166, 198
SinI GGWCC 1 cut(s) 215
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 1 cut(s) 146
SsiI CCGC 1 cut(s) 248
SspMI CTAG 2 cut(s) 51, 99
TaiI ACGT 1 cut(s) 108
TaqI TCGA 4 cut(s) 14, 44, 56, 64
TaqII GACCGA 1 cut(s) 10
TasI AATT 1 cut(s) 146
TscAI CASTG 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 159, 195
TspGWI ACGGA 1 cut(s) 98
TspRI CASTG 1 cut(s) 231
VpaK11BI GGWCC 1 cut(s) 215
XmnI GAANNNNTTC 1 cut(s) 36
XspI CTAG 2 cut(s) 51, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.