Rmu_sc0002205.1_g000004

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002205.1
OG0000492
Physical Location & Seq
Reverse (-)
26426 .. 27142
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002205.1_g000004.1.cds

Sequence Viewer

Length: 717 bp
atgcgttggattattgggaatggtcataatataaaattttggaccttcaattggatctatgatttccccttgattcacctggttgatgacactagtagagcctctatagatctagacgagtctgtttcagattatttagttaatggagtttggaatattgagaaactctcccaatacttagagtcttcgattgttagagatatctcttttgttaatcttcctttttctgacagggatgatgagtttgtttggggactgacttctaatgggaaattttccatcaaatcagccacctggttccaatgccatcagaatgttcaccctaagactaatttgctgaacaaactttggaagctaaatattccccccaaagcaaaaatttttgcttggctccttgttagagatagactaaaaacaagagcaagacttgctcgattcaatgctagtatcaatcctatttgtggcctgtgtaataatgatgtggaaaatttggatcatatctttcgatcttgcccaaaagttcgggatgtttggtctatggctaatctgaatcagagtcctacttcctttaattgttttgatgattggattgtttacatgtttcagaatgctccaatggatgctttggaaaaatgtttgcttctttgttggcaaatatggaatcagcgtaagacttataaattctggtgtcacaacaaggattatggatgtggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

238

Amino Acids

28.1

Weight (kDa)

8.34

Isoelectric Point (pI)

39.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000492)

Species Orthologous Gene IDs
arabidopsis_thaliana ATMG01250
fragaria_vesca FvH4_1g20711 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g28252 FvH4_3g31041 FvH4_4g00611 FvH4_5g15581 FvH4_5g21911 FvH4_5g35851 FvH4_6g24331 FvH4_6g34741
malus_domestica MD07G1291800.v1.1 MD09G1222500.v1.1
prunus_persica Prupe.1G162400_v2.0.a1 Prupe.1G210400_v2.0.a1 Prupe.6G308200_v2.0.a1
pyrus_communis pycom05g02580 pycom12g09210 pycom12g15310 pycom16g09140
rosa_chinensis RchiOBHm_Chr3g0484711 RchiOBHm_Chr4g0393411 RchiOBHm_Chr4g0397521 RchiOBHm_Chr4g0404571 RchiOBHm_Chr4g0418351 RchiOBHm_Chr5g0060311 RchiOBHm_Chr6g0301391 RchiOBHm_Chr7g0229871
rosa_laevigata RLG00000007836 RLG00000025145
rosa_multiflora Rmu_co8327795.1_g000001 Rmu_sc0000469.1_g000005 Rmu_sc0000498.1_g000050 Rmu_sc0000558.1_g000007 Rmu_sc0000693.1_g000082 Rmu_sc0000711.1_g000011 Rmu_sc0000814.1_g000039 Rmu_sc0001366.1_g000005 Rmu_sc0002205.1_g000004 Rmu_sc0002283.1_g000086 Rmu_sc0002406.1_g000011 Rmu_sc0002735.1_g000022 Rmu_sc0003545.1_g000004 Rmu_sc0004406.1_g000009 Rmu_sc0006301.1_g000009 Rmu_sc0006754.1_g000004 Rmu_sc0007324.1_g000010 Rmu_sc0008199.1_g000002 Rmu_sc0008563.1_g000009 Rmu_sc0009777.1_g000007 Rmu_sc0010560.1_g000011 Rmu_sc0011095.1_g000004 Rmu_sc0012101.1_g000004 Rmu_sc0014150.1_g000009 Rmu_sc0020270.1_g000004 Rmu_sc0021327.1_g000001 Rmu_sc0031326.1_g000003 Rmu_ssc0000116.1_g000050 Rmu_ssc0000368.1_g000056
rosa_roxburghii Rroxscaffold_2G00110080 Rroxscaffold_2G00141700 Rroxscaffold_2G00142400
rosa_rugosa Rorug01G0104400 Rorug01G0204500 Rorug02G0225600 Rorug02G0262000.1 Rorug02G0526700 Rorug03G0082000 Rorug03G0102500.1 Rorug04G0106400 Rorug04G0200200 Rorug05G0021900.1 Rorug05G0240000 Rorug05G0326500 Rorug05G0529200 Rorug07G0136100
rosa_samantha Rh1AG352100 Rh6DG494100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 678
AclWI GGATC 2 cut(s) 62, 501
AcsI RAATTY 5 cut(s) 35, 272, 378, 487, 680
AfiI CCNNNNNNNGG 2 cut(s) 51, 461
AflIII ACRYGT 1 cut(s) 597
AgsI TTSAA 2 cut(s) 49, 439
AhlI ACTAGT 1 cut(s) 92
AjnI CCWGG 2 cut(s) 78, 293
AluBI AGCT 1 cut(s) 355
AluI AGCT 1 cut(s) 355
AlwI GGATC 2 cut(s) 62, 501
AoxI GGCC 1 cut(s) 463
ApoI RAATTY 5 cut(s) 35, 272, 378, 487, 680
AspS9I GGNCC 1 cut(s) 42
AsuHPI GGTGA 2 cut(s) 68, 311
AvaII GGWCC 1 cut(s) 42
BbsI GAAGAC 1 cut(s) 177
BccI CCATC 2 cut(s) 287, 315
BciT130I CCWGG 2 cut(s) 80, 295
BcuI ACTAGT 1 cut(s) 92
BfaI CTAG 3 cut(s) 93, 113, 444
BfmI CTRYAG 1 cut(s) 105
BglII AGATCT 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 80, 295
Bme18I GGWCC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 2 cut(s) 299, 392
BmrFI CCNGG 2 cut(s) 80, 295
BmsI GCATC 1 cut(s) 610
BpiI GAAGAC 1 cut(s) 177
BplI GAGNNNNNCTC 2 cut(s) 152, 184
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 461
BseBI CCWGG 2 cut(s) 80, 295
BseGI GGATG 4 cut(s) 241, 532, 625, 713
BseLI CCNNNNNNNGG 2 cut(s) 51, 461
BshFI GGCC 1 cut(s) 465
BslFI GGGAC 1 cut(s) 267
BslI CCNNNNNNNGG 2 cut(s) 51, 461
BsmFI GGGAC 1 cut(s) 267
BsmI GAATGC 1 cut(s) 613
BsnI GGCC 1 cut(s) 465
Bsp143I GATC 4 cut(s) 54, 109, 493, 506
BspANI GGCC 1 cut(s) 465
BspLI GGNNCC 2 cut(s) 299, 392
BspPI GGATC 2 cut(s) 62, 501
BssMI GATC 4 cut(s) 54, 109, 493, 506
Bst2UI CCWGG 2 cut(s) 80, 295
BstAPI GCANNNNNTGC 1 cut(s) 428
BstDEI CTNAG 2 cut(s) 178, 324
BstF5I GGATG 4 cut(s) 241, 532, 625, 713
BstKTI GATC 4 cut(s) 57, 112, 496, 509
BstMBI GATC 4 cut(s) 54, 109, 493, 506
BstMWI GCNNNNNNNGC 1 cut(s) 428
BstNI CCWGG 2 cut(s) 80, 295
BstNSI RCATGY 1 cut(s) 601
BstSCI CCNGG 2 cut(s) 78, 293
BstSFI CTRYAG 1 cut(s) 105
BstV2I GAAGAC 1 cut(s) 177
BstX2I RGATCY 2 cut(s) 54, 109
BstYI RGATCY 2 cut(s) 54, 109
BsuRI GGCC 1 cut(s) 465
BtsCI GGATG 4 cut(s) 241, 532, 625, 713
Cfr13I GGNCC 1 cut(s) 42
CsiI ACCWGGT 2 cut(s) 78, 293
CviAII CATG 1 cut(s) 598
CviJI RGCY 6 cut(s) 101, 290, 355, 391, 465, 542
CviKI_1 RGCY 6 cut(s) 101, 290, 355, 391, 465, 542
DdeI CTNAG 2 cut(s) 178, 324
DpnI GATC 4 cut(s) 56, 111, 495, 508
DpnII GATC 4 cut(s) 54, 109, 493, 506
Eco32I GATATC 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 42
EcoRII CCWGG 2 cut(s) 78, 293
EcoRV GATATC 1 cut(s) 202
FaeI CATG 1 cut(s) 601
FaqI GGGAC 1 cut(s) 267
FatI CATG 1 cut(s) 597
FokI GGATG 3 cut(s) 248, 539, 632
FspBI CTAG 3 cut(s) 93, 113, 444
HaeIII GGCC 1 cut(s) 465
Hin1II CATG 1 cut(s) 601
HinfI GANTC 7 cut(s) 73, 119, 182, 435, 550, 556, 661
HphI GGTGA 2 cut(s) 68, 311
Hpy166II GTNNAC 2 cut(s) 319, 595
Hpy188I TCNGA 6 cut(s) 130, 229, 312, 549, 555, 606
Hpy188III TCNNGA 2 cut(s) 113, 524
Hpy8I GTNNAC 2 cut(s) 319, 595
HpyAV CCTTC 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 428
HpyF3I CTNAG 2 cut(s) 178, 324
Hsp92II CATG 1 cut(s) 601
Kzo9I GATC 4 cut(s) 54, 109, 493, 506
LmnI GCTCC 2 cut(s) 396, 616
LpnPI CCDG 7 cut(s) 65, 92, 217, 280, 307, 479, 670
LweI GCATC 1 cut(s) 610
MabI ACCWGGT 2 cut(s) 78, 293
MaeI CTAG 3 cut(s) 93, 113, 444
MaeIII GTNAC 1 cut(s) 689
MalI GATC 4 cut(s) 56, 111, 495, 508
MboI GATC 4 cut(s) 54, 109, 493, 506
MboII GAAGA 2 cut(s) 177, 209
MfeI CAATTG 1 cut(s) 49
MflI RGATCY 2 cut(s) 54, 109
MluCI AATT 8 cut(s) 35, 49, 272, 331, 378, 487, 571, 680
MlyI GAGTC 3 cut(s) 128, 191, 565
MnlI CCTC 1 cut(s) 112
MseI TTAA 3 cut(s) 141, 213, 570
MslI CAYNNNNRTG 1 cut(s) 312
MspR9I CCNGG 2 cut(s) 80, 295
MunI CAATTG 1 cut(s) 49
Mva1269I GAATGC 1 cut(s) 613
MvaI CCWGG 2 cut(s) 80, 295
MwoI GCNNNNNNNGC 1 cut(s) 428
NdeII GATC 4 cut(s) 54, 109, 493, 506
NlaIII CATG 1 cut(s) 601
NlaIV GGNNCC 2 cut(s) 299, 392
NmuCI GTSAC 1 cut(s) 689
NspI RCATGY 1 cut(s) 601
PciI ACATGT 1 cut(s) 597
PctI GAATGC 1 cut(s) 613
PfeI GAWTC 4 cut(s) 73, 435, 550, 661
PleI GAGTC 3 cut(s) 127, 190, 564
PpsI GAGTC 3 cut(s) 127, 190, 564
PscI ACATGT 1 cut(s) 597
PsiI TTATAA 1 cut(s) 678
Psp6I CCWGG 2 cut(s) 78, 293
PspGI CCWGG 2 cut(s) 78, 293
PspN4I GGNNCC 2 cut(s) 299, 392
PspPI GGNCC 1 cut(s) 42
PsuI RGATCY 2 cut(s) 54, 109
RseI CAYNNNNRTG 1 cut(s) 312
SaqAI TTAA 3 cut(s) 141, 213, 570
Sau3AI GATC 4 cut(s) 54, 109, 493, 506
Sau96I GGNCC 1 cut(s) 42
SchI GAGTC 3 cut(s) 128, 191, 565
ScrFI CCNGG 2 cut(s) 80, 295
SetI ASST 4 cut(s) 47, 81, 296, 357
SexAI ACCWGGT 2 cut(s) 78, 293
SfaNI GCATC 1 cut(s) 610
SfcI CTRYAG 1 cut(s) 105
SinI GGWCC 1 cut(s) 42
SmiMI CAYNNNNRTG 1 cut(s) 312
SpeI ACTAGT 1 cut(s) 92
Sse9I AATT 8 cut(s) 35, 49, 272, 331, 378, 487, 571, 680
SspI AATATT 2 cut(s) 157, 361
SspMI CTAG 3 cut(s) 93, 113, 444
StyD4I CCNGG 2 cut(s) 78, 293
TaqI TCGA 3 cut(s) 188, 433, 505
TasI AATT 8 cut(s) 35, 49, 272, 331, 378, 487, 571, 680
TfiI GAWTC 4 cut(s) 73, 435, 550, 661
Tru1I TTAA 3 cut(s) 141, 213, 570
Tru9I TTAA 3 cut(s) 141, 213, 570
TseFI GTSAC 1 cut(s) 689
Tsp45I GTSAC 1 cut(s) 689
VpaK11BI GGWCC 1 cut(s) 42
XapI RAATTY 5 cut(s) 35, 272, 378, 487, 680
XbaI TCTAGA 1 cut(s) 112
XceI RCATGY 1 cut(s) 601
XspI CTAG 3 cut(s) 93, 113, 444
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.