Rmu_sc0012101.1_g000004

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012101.1
OG0000492
Physical Location & Seq
Reverse (-)
11991 .. 12756
766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012101.1_g000004.1.cds

Sequence Viewer

Length: 657 bp
atgaatgctaaagagcttcttattagaatttccaagaagctcagtggctggaaaagtaacactttgtctagggctggaaaactaactttgcttaaatcaaatttatccagtatacctaaccatatcatgtcttgtttcaggtgtcctcccaaggtgactaattccattgacagacaaatgaggaactttttttggggaaatgacttgagaagtccccctgttacttggaatcaggtttgtttacctaagaatcaaggtggtctcagtgttaggccctctgctttttttaataatgcagctttagctaaacttggttggaagctcttaactgataaagataactggtgggttcagttgggaatgagatggataattggttcgggcaaggatgttaagttttggacttttgactgggtttttgagtttcctttattcaatcttttggatgatgctgctaaggctgctattgatttaaatgaatctgttagtgactatatcacttttgggaactggaatgttcaaaagttggcttcggttttggatcagcatattattgaccatattgttggcattcctattccggtttcggagttgaaagaccattttgtttggggtcctgtagcagatggttctttctccattaaatctgctacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

218

Amino Acids

24.65

Weight (kDa)

9.43

Isoelectric Point (pI)

29.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000492)

Species Orthologous Gene IDs
arabidopsis_thaliana ATMG01250
fragaria_vesca FvH4_1g20711 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g24611 FvH4_3g28252 FvH4_3g31041 FvH4_4g00611 FvH4_5g15581 FvH4_5g21911 FvH4_5g35851 FvH4_6g24331 FvH4_6g34741
malus_domestica MD07G1291800.v1.1 MD09G1222500.v1.1
prunus_persica Prupe.1G162400_v2.0.a1 Prupe.1G210400_v2.0.a1 Prupe.6G308200_v2.0.a1
pyrus_communis pycom05g02580 pycom12g09210 pycom12g15310 pycom16g09140
rosa_chinensis RchiOBHm_Chr3g0484711 RchiOBHm_Chr4g0393411 RchiOBHm_Chr4g0397521 RchiOBHm_Chr4g0404571 RchiOBHm_Chr4g0418351 RchiOBHm_Chr5g0060311 RchiOBHm_Chr6g0301391 RchiOBHm_Chr7g0229871
rosa_laevigata RLG00000007836 RLG00000025145
rosa_multiflora Rmu_co8327795.1_g000001 Rmu_sc0000469.1_g000005 Rmu_sc0000498.1_g000050 Rmu_sc0000558.1_g000007 Rmu_sc0000693.1_g000082 Rmu_sc0000711.1_g000011 Rmu_sc0000814.1_g000039 Rmu_sc0001366.1_g000005 Rmu_sc0002205.1_g000004 Rmu_sc0002283.1_g000086 Rmu_sc0002406.1_g000011 Rmu_sc0002735.1_g000022 Rmu_sc0003545.1_g000004 Rmu_sc0004406.1_g000009 Rmu_sc0006301.1_g000009 Rmu_sc0006754.1_g000004 Rmu_sc0007324.1_g000010 Rmu_sc0008199.1_g000002 Rmu_sc0008563.1_g000009 Rmu_sc0009777.1_g000007 Rmu_sc0010560.1_g000011 Rmu_sc0011095.1_g000004 Rmu_sc0012101.1_g000004 Rmu_sc0014150.1_g000009 Rmu_sc0020270.1_g000004 Rmu_sc0021327.1_g000001 Rmu_sc0031326.1_g000003 Rmu_ssc0000116.1_g000050 Rmu_ssc0000368.1_g000056
rosa_roxburghii Rroxscaffold_2G00110080 Rroxscaffold_2G00141700 Rroxscaffold_2G00142400
rosa_rugosa Rorug01G0104400 Rorug01G0204500 Rorug02G0225600 Rorug02G0262000.1 Rorug02G0526700 Rorug03G0082000 Rorug03G0102500.1 Rorug04G0106400 Rorug04G0200200 Rorug05G0021900.1 Rorug05G0240000 Rorug05G0326500 Rorug05G0529200 Rorug07G0136100
rosa_samantha Rh1AG352100 Rh6DG494100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 112
AclWI GGATC 1 cut(s) 549
AcsI RAATTY 2 cut(s) 27, 100
AgsI TTSAA 3 cut(s) 436, 521, 595
AloI GAACNNNNNNTCC 2 cut(s) 361, 393
AluBI AGCT 5 cut(s) 16, 40, 299, 305, 322
AluI AGCT 5 cut(s) 16, 40, 299, 305, 322
Alw26I GTCTC 1 cut(s) 266
AlwI GGATC 1 cut(s) 549
AlwNI CAGNNNCTG 1 cut(s) 48
AoxI GGCC 1 cut(s) 272
ApeKI GCWGC 3 cut(s) 296, 452, 461
ApoI RAATTY 2 cut(s) 27, 100
ArsI GACNNNNNNTTYG 2 cut(s) 401, 433
AspS9I GGNCC 2 cut(s) 273, 614
AsuHPI GGTGA 1 cut(s) 166
AvaII GGWCC 1 cut(s) 614
BbvI GCAGC 3 cut(s) 308, 439, 448
BccI CCATC 2 cut(s) 360, 620
BcoDI GTCTC 1 cut(s) 266
BfaI CTAG 1 cut(s) 69
BfmI CTRYAG 1 cut(s) 618
BisI GCNGC 3 cut(s) 297, 453, 462
BlsI GCNGC 3 cut(s) 298, 454, 463
Bme18I GGWCC 1 cut(s) 614
BmgT120I GGNCC 2 cut(s) 273, 614
BmiI GGNNCC 1 cut(s) 615
BmrI ACTGGG 1 cut(s) 421
BmsI GCATC 1 cut(s) 439
BmuI ACTGGG 1 cut(s) 421
Bpu10I CCTNAGC 1 cut(s) 456
BpuEI CTTGAG 1 cut(s) 226
BsaI GGTCTC 1 cut(s) 266
BsaJI CCNNGG 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 580
Bse1I ACTGG 4 cut(s) 108, 347, 416, 515
BseDI CCNNGG 1 cut(s) 150
BseGI GGATG 2 cut(s) 394, 451
BseMII CTCAG 2 cut(s) 55, 277
BseNI ACTGG 4 cut(s) 108, 347, 416, 515
BseXI GCAGC 3 cut(s) 308, 439, 448
BshFI GGCC 1 cut(s) 274
BsiSI CCGG 1 cut(s) 581
BslFI GGGAC 1 cut(s) 198
BsmAI GTCTC 1 cut(s) 266
BsmFI GGGAC 1 cut(s) 198
BsmI GAATGC 2 cut(s) 10, 570
BsnI GGCC 1 cut(s) 274
Bso31I GGTCTC 1 cut(s) 266
Bsp143I GATC 1 cut(s) 541
BspANI GGCC 1 cut(s) 274
BspCNI CTCAG 2 cut(s) 54, 276
BspLI GGNNCC 1 cut(s) 615
BspPI GGATC 1 cut(s) 549
BspTNI GGTCTC 1 cut(s) 266
BsrI ACTGG 4 cut(s) 108, 347, 416, 515
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 1 cut(s) 541
BssNAI GTATAC 1 cut(s) 113
BssT1I CCWWGG 1 cut(s) 150
Bst1107I GTATAC 1 cut(s) 113
BstDEI CTNAG 4 cut(s) 41, 246, 263, 456
BstF5I GGATG 2 cut(s) 394, 451
BstKTI GATC 1 cut(s) 544
BstMAI GTCTC 1 cut(s) 266
BstMBI GATC 1 cut(s) 541
BstMWI GCNNNNNNNGC 3 cut(s) 302, 458, 461
BstSFI CTRYAG 1 cut(s) 618
BstV1I GCAGC 3 cut(s) 308, 439, 448
BstXI CCANNNNNNTGG 1 cut(s) 566
BstZ17I GTATAC 1 cut(s) 113
BsuRI GGCC 1 cut(s) 274
BtsCI GGATG 2 cut(s) 394, 451
BtsIMutI CAGTG 2 cut(s) 49, 271
CaiI CAGNNNCTG 1 cut(s) 48
Cfr13I GGNCC 2 cut(s) 273, 614
CviAII CATG 1 cut(s) 127
DdeI CTNAG 4 cut(s) 41, 246, 263, 456
DpnI GATC 1 cut(s) 543
DpnII GATC 1 cut(s) 541
DraI TTTAAA 1 cut(s) 474
Eco130I CCWWGG 1 cut(s) 150
Eco31I GGTCTC 1 cut(s) 266
Eco47I GGWCC 1 cut(s) 614
EcoO109I RGGNCCY 2 cut(s) 273, 614
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 130
FaiI YATR 6 cut(s) 113, 123, 128, 495, 549, 561
FalI AAGNNNNNCTT 3 cut(s) 35, 46, 78
FaqI GGGAC 1 cut(s) 198
FatI CATG 1 cut(s) 126
FblI GTMKAC 1 cut(s) 112
Fnu4HI GCNGC 3 cut(s) 297, 453, 462
FokI GGATG 2 cut(s) 401, 458
Fsp4HI GCNGC 3 cut(s) 297, 453, 462
FspBI CTAG 1 cut(s) 69
GluI GCNGC 3 cut(s) 297, 453, 462
HaeIII GGCC 1 cut(s) 274
HapII CCGG 1 cut(s) 581
Hin1II CATG 1 cut(s) 130
HinfI GANTC 3 cut(s) 229, 250, 479
HpaII CCGG 1 cut(s) 581
HphI GGTGA 1 cut(s) 166
Hpy166II GTNNAC 2 cut(s) 113, 242
Hpy188I TCNGA 1 cut(s) 589
Hpy8I GTNNAC 2 cut(s) 113, 242
HpyCH4V TGCA 1 cut(s) 296
HpyF10VI GCNNNNNNNGC 3 cut(s) 302, 458, 461
HpyF3I CTNAG 4 cut(s) 41, 246, 263, 456
Hsp92II CATG 1 cut(s) 130
Kzo9I GATC 1 cut(s) 541
Lsp1109I GCAGC 3 cut(s) 308, 439, 448
LweI GCATC 1 cut(s) 439
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 4 cut(s) 56, 154, 220, 488
MalI GATC 1 cut(s) 543
MboI GATC 1 cut(s) 541
MluCI AATT 4 cut(s) 27, 100, 160, 372
MmeI TCCRAC 1 cut(s) 296
MnlI CCTC 3 cut(s) 156, 174, 286
MseI TTAA 6 cut(s) 93, 288, 326, 393, 473, 642
MspI CCGG 1 cut(s) 581
Mva1269I GAATGC 2 cut(s) 10, 570
MwoI GCNNNNNNNGC 3 cut(s) 302, 458, 461
NdeII GATC 1 cut(s) 541
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 615
NmuCI GTSAC 2 cut(s) 154, 488
PctI GAATGC 2 cut(s) 10, 570
PfeI GAWTC 3 cut(s) 229, 250, 479
PkrI GCNGC 3 cut(s) 298, 454, 463
PpuMI RGGWCCY 1 cut(s) 614
Psp5II RGGWCCY 1 cut(s) 614
PspN4I GGNNCC 1 cut(s) 615
PspPI GGNCC 2 cut(s) 273, 614
PspPPI RGGWCCY 1 cut(s) 614
PstNI CAGNNNCTG 1 cut(s) 48
SaqAI TTAA 6 cut(s) 93, 288, 326, 393, 473, 642
SatI GCNGC 3 cut(s) 297, 453, 462
Sau3AI GATC 1 cut(s) 541
Sau96I GGNCC 2 cut(s) 273, 614
SfaNI GCATC 1 cut(s) 439
SfcI CTRYAG 1 cut(s) 618
SinI GGWCC 1 cut(s) 614
SmiI ATTTAAAT 1 cut(s) 474
SmlI CTYRAG 1 cut(s) 205
SmoI CTYRAG 1 cut(s) 205
Sse9I AATT 4 cut(s) 27, 100, 160, 372
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 150
SwaI ATTTAAAT 1 cut(s) 474
TasI AATT 4 cut(s) 27, 100, 160, 372
TfiI GAWTC 3 cut(s) 229, 250, 479
Tru1I TTAA 6 cut(s) 93, 288, 326, 393, 473, 642
Tru9I TTAA 6 cut(s) 93, 288, 326, 393, 473, 642
TscAI CASTG 2 cut(s) 49, 271
TseFI GTSAC 2 cut(s) 154, 488
TseI GCWGC 3 cut(s) 296, 452, 461
Tsp45I GTSAC 2 cut(s) 154, 488
TspDTI ATGAA 2 cut(s) 17, 492
TspRI CASTG 2 cut(s) 49, 271
VpaK11BI GGWCC 1 cut(s) 614
XapI RAATTY 2 cut(s) 27, 100
XmiI GTMKAC 1 cut(s) 112
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.