Rmu_sc0003147.1_g000018
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003147.1
Physical Location & Seq
Forward (+)
73303 .. 75027
1725 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003147.1_g000018.1.cds

Sequence Viewer

Length: 708 bp
atggagggtttcggcgtgagaaaaggtgcatggactaaagaggaagatgaacttctgagacaggtcatcgaaaagcatggagaaggaaaatggcatcaggttcctttcaaagcaggcttaaacagatgcaggaagagctgtaggctgaggtggctaaattatttgaagccaaatatcaagagaggagagtttacagttgatgaagttgatatgatcatcagacttcataagcttctaggaaacaggtggtccttaattgctggaagactaccgggaagaacagccaacgatgtaaagaactattggaatacttatcaacggaaaaagaatcaaaagatgacttcaggcgcaaaaaaaatgaaagataaatcccaaaaaaacacaatcgcccctttggttgtaagacctcgaccacgaaccttcatcaaaaggttgaattttttggaaagagatgccaatttagagcatattcattcagaagagaattcttccacttctttaccaacagcaccaccacaaactctagaattagagaatgtaattgattggtggaaagttgtatctgaagacagtacaggaagcattgatagaacaacatgttctagtcttggtttagaggacgacttcttcacaaacttctgggttgaagatatggtacaattgtcaactatagatggccatgatctagtcaacaacttctacgcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

235

Amino Acids

27.35

Weight (kDa)

9.3

Isoelectric Point (pI)

39.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000402)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G56650 AT1G66370 AT1G66380 AT1G66380 AT1G66390
fragaria_vesca FvH4_1g22020 FvH4_1g22040 FvH4_5g34660 FvH4_5g34660 FvH4_6g01170
malus_domestica MD04G1235800.v1.1 MD05G1276500.v1.1 MD05G1276700.v1.1 MD09G1265100.v1.1 MD09G1278400.v1.1 MD09G1278600.v1.1 MD17G1261000.v1.1 MD17G1261100.v1.1
prunus_persica Prupe.3G163000_v2.0.a1 Prupe.3G163100_v2.0.a1 Prupe.3G163300_v2.0.a1 Prupe.6G176200_v2.0.a1 Prupe.6G176300_v2.0.a1 Prupe.6G355700_v2.0.a1
pyrus_communis pycom05g25770
rosa_chinensis RchiOBHm_Chr2g0116041 RchiOBHm_Chr2g0116071 RchiOBHm_Chr3g0448721 RchiOBHm_Chr3g0492711 RchiOBHm_Chr4g0415831 RchiOBHm_Chr4g0415891 RchiOBHm_Chr7g0235271
rosa_laevigata RLG00000001168 RLG00000008031 RLG00000008035 RLG00000018232 RLG00000018234 RLG00000025877
rosa_multiflora Rmu_sc0003147.1_g000006 Rmu_sc0003147.1_g000008 Rmu_sc0003147.1_g000018 Rmu_sc0004637.1_g000011 Rmu_sc0004657.1_g000064 Rmu_sc0013612.1_g000010 Rmu_sc0017810.1_g000002 Rmu_sc0027086.1_g000003
rosa_roxburghii Rroxscaffold_2G00127520 Rroxscaffold_2G00127530 Rroxscaffold_2G00127560 Rroxscaffold_2G00128380 Rroxscaffold_5G00359700 Rroxscaffold_5G00359730 Rroxscaffold_6G00392130
rosa_rugosa Rorug01G0050500 Rorug02G0202600 Rorug02G0202700 Rorug02G0202700 Rorug02G0202900 Rorug02G0203000 Rorug02G0616200 Rorug03G0256600 Rorug04G0137200 Rorug04G0247500
rosa_samantha Rh2AG259100 Rh2AG259200 Rh2BG270400 Rh2BG270700 Rh2BG270800 Rh2CG265700 Rh2CG265900 Rh2DG267400 Rh2DG267600 Rh3AG014400 Rh3AG069900 Rh3AG305900 Rh3BG014200 Rh3BG342300 Rh3CG013200 Rh3DG014800 Rh3DG341700 Rh4AG198700 Rh4AG199200 Rh4AG199500 Rh4BG197000 Rh4CG210100 Rh4DG196500 Rh4DG197000 Rh4DG197300 Rh7AG444500 Rh7DG433400
rosa_wichuraiana Rw0G010310 Rw2G020310 Rw2G020320 Rw2G020330 Rw3G001070 Rw3G026940 Rw4G016830 Rw4G016880 Rw4G016910 Rw7G036930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 676
AcsI RAATTY 2 cut(s) 436, 484
AcuI CTGAAG 2 cut(s) 327, 585
AfaI GTAC 2 cut(s) 574, 657
AflIII ACRYGT 1 cut(s) 596
AgsI TTSAA 4 cut(s) 109, 166, 436, 647
AluBI AGCT 2 cut(s) 138, 232
AluI AGCT 2 cut(s) 138, 232
Alw26I GTCTC 1 cut(s) 52
AoxI GGCC 1 cut(s) 676
ApoI RAATTY 2 cut(s) 436, 484
AspLEI GCGC 1 cut(s) 350
AspS9I GGNCC 1 cut(s) 249
AsuC2I CCSGG 1 cut(s) 273
AvaII GGWCC 1 cut(s) 249
BaeI ACNNNNGTAYC 2 cut(s) 647, 680
BalI TGGCCA 1 cut(s) 678
BarI GAAGNNNNNNTAC 2 cut(s) 639, 671
BbsI GAAGAC 2 cut(s) 271, 573
BbvCI CCTCAGC 1 cut(s) 146
BccI CCATC 1 cut(s) 668
BclI TGATCA 1 cut(s) 213
BcnI CCSGG 1 cut(s) 273
BcoDI GTCTC 1 cut(s) 52
BfaI CTAG 4 cut(s) 236, 524, 603, 686
BfmI CTRYAG 2 cut(s) 139, 669
Bme1390I CCNGG 1 cut(s) 273
Bme18I GGWCC 1 cut(s) 249
BmgT120I GGNCC 1 cut(s) 249
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 273
BmsI GCATC 3 cut(s) 103, 116, 442
BpiI GAAGAC 2 cut(s) 271, 573
Bpu10I CCTNAGC 1 cut(s) 146
BpuMI CCSGG 1 cut(s) 273
BseMII CTCAG 2 cut(s) 47, 137
BseRI GAGGAG 1 cut(s) 198
BshFI GGCC 1 cut(s) 678
BsiSI CCGG 1 cut(s) 272
BsmAI GTCTC 1 cut(s) 52
BsnI GGCC 1 cut(s) 678
Bsp143I GATC 2 cut(s) 213, 682
BspANI GGCC 1 cut(s) 678
BspCNI CTCAG 2 cut(s) 48, 138
BspLI GGNNCC 1 cut(s) 102
BspQI GCTCTTC 1 cut(s) 128
BssMI GATC 2 cut(s) 213, 682
Bst4CI ACNGT 2 cut(s) 196, 572
Bst6I CTCTTC 2 cut(s) 128, 474
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 2 cut(s) 56, 146
BstHHI GCGC 1 cut(s) 350
BstKTI GATC 2 cut(s) 216, 685
BstMAI GTCTC 1 cut(s) 52
BstMBI GATC 2 cut(s) 213, 682
BstMWI GCNNNNNNNGC 2 cut(s) 135, 151
BstNSI RCATGY 1 cut(s) 600
BstSCI CCNGG 1 cut(s) 271
BstSFI CTRYAG 2 cut(s) 139, 669
BstV2I GAAGAC 2 cut(s) 271, 573
BsuRI GGCC 1 cut(s) 678
Cac8I GCNNGC 1 cut(s) 115
CfoI GCGC 1 cut(s) 350
Cfr13I GGNCC 1 cut(s) 249
Csp6I GTAC 2 cut(s) 573, 656
CviAII CATG 5 cut(s) 30, 77, 597, 680, 705
CviJI RGCY 8 cut(s) 117, 138, 145, 154, 169, 232, 284, 678
CviKI_1 RGCY 8 cut(s) 117, 138, 145, 154, 169, 232, 284, 678
CviQI GTAC 2 cut(s) 573, 656
DdeI CTNAG 2 cut(s) 56, 146
DpnI GATC 2 cut(s) 215, 684
DpnII GATC 2 cut(s) 213, 682
EaeI YGGCCR 1 cut(s) 676
Eam1104I CTCTTC 2 cut(s) 128, 474
EarI CTCTTC 2 cut(s) 128, 474
Eco47I GGWCC 1 cut(s) 249
Eco57I CTGAAG 2 cut(s) 327, 585
EcoRI GAATTC 1 cut(s) 484
FaeI CATG 5 cut(s) 33, 80, 600, 683, 708
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FatI CATG 5 cut(s) 29, 76, 596, 679, 704
FbaI TGATCA 1 cut(s) 213
FspBI CTAG 4 cut(s) 236, 524, 603, 686
GlaI GCGC 1 cut(s) 349
HaeIII GGCC 1 cut(s) 678
HapII CCGG 1 cut(s) 272
HhaI GCGC 1 cut(s) 350
Hin1II CATG 5 cut(s) 33, 80, 600, 683, 708
Hin6I GCGC 1 cut(s) 348
HinP1I GCGC 1 cut(s) 348
HincII GTYRAC 2 cut(s) 666, 691
HindII GTYRAC 2 cut(s) 666, 691
HindIII AAGCTT 1 cut(s) 230
HinfI GANTC 1 cut(s) 328
HpaII CCGG 1 cut(s) 272
Hpy166II GTNNAC 3 cut(s) 192, 666, 691
Hpy188I TCNGA 4 cut(s) 57, 221, 478, 565
Hpy188III TCNNGA 2 cut(s) 178, 524
Hpy8I GTNNAC 3 cut(s) 192, 666, 691
HpyAV CCTTC 2 cut(s) 77, 430
HpyCH4III ACNGT 2 cut(s) 196, 572
HpyCH4V TGCA 2 cut(s) 29, 129
HpyF10VI GCNNNNNNNGC 2 cut(s) 135, 151
HpyF3I CTNAG 2 cut(s) 56, 146
Hsp92II CATG 5 cut(s) 33, 80, 600, 683, 708
HspAI GCGC 1 cut(s) 348
Ksp22I TGATCA 1 cut(s) 213
Kzo9I GATC 2 cut(s) 213, 682
LguI GCTCTTC 1 cut(s) 128
LweI GCATC 3 cut(s) 103, 116, 442
MaeI CTAG 4 cut(s) 236, 524, 603, 686
MalI GATC 2 cut(s) 215, 684
MboI GATC 2 cut(s) 213, 682
MboII GAAGA 9 cut(s) 56, 145, 276, 288, 480, 491, 578, 619, 659
MfeI CAATTG 1 cut(s) 659
MlsI TGGCCA 1 cut(s) 678
MluCI AATT 8 cut(s) 157, 255, 436, 457, 484, 527, 540, 659
MluNI TGGCCA 1 cut(s) 678
MnlI CCTC 5 cut(s) 34, 141, 176, 417, 610
Mox20I TGGCCA 1 cut(s) 678
MscI TGGCCA 1 cut(s) 678
MseI TTAA 2 cut(s) 119, 254
Msp20I TGGCCA 1 cut(s) 678
MspI CCGG 1 cut(s) 272
MspR9I CCNGG 1 cut(s) 273
MunI CAATTG 1 cut(s) 659
MwoI GCNNNNNNNGC 2 cut(s) 135, 151
NciI CCSGG 1 cut(s) 273
NdeII GATC 2 cut(s) 213, 682
NlaIII CATG 5 cut(s) 33, 80, 600, 683, 708
NlaIV GGNNCC 1 cut(s) 102
NspI RCATGY 1 cut(s) 600
PciI ACATGT 1 cut(s) 596
PciSI GCTCTTC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 328
PscI ACATGT 1 cut(s) 596
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 249
RsaI GTAC 2 cut(s) 574, 657
RsaNI GTAC 2 cut(s) 573, 656
SapI GCTCTTC 1 cut(s) 128
SaqAI TTAA 2 cut(s) 119, 254
Sau3AI GATC 2 cut(s) 213, 682
Sau96I GGNCC 1 cut(s) 249
ScrFI CCNGG 1 cut(s) 273
SfaNI GCATC 3 cut(s) 103, 116, 442
SfcI CTRYAG 2 cut(s) 139, 669
SinI GGWCC 1 cut(s) 249
Sse9I AATT 8 cut(s) 157, 255, 436, 457, 484, 527, 540, 659
SspMI CTAG 4 cut(s) 236, 524, 603, 686
StyD4I CCNGG 1 cut(s) 271
TaaI ACNGT 2 cut(s) 196, 572
TaqI TCGA 2 cut(s) 69, 409
TasI AATT 8 cut(s) 157, 255, 436, 457, 484, 527, 540, 659
TatI WGTACW 1 cut(s) 572
TfiI GAWTC 1 cut(s) 328
Tru1I TTAA 2 cut(s) 119, 254
Tru9I TTAA 2 cut(s) 119, 254
TspDTI ATGAA 6 cut(s) 63, 215, 216, 374, 412, 461
TspGWI ACGGA 1 cut(s) 334
VpaK11BI GGWCC 1 cut(s) 249
XapI RAATTY 2 cut(s) 436, 484
XbaI TCTAGA 1 cut(s) 523
XceI RCATGY 1 cut(s) 600
XspI CTAG 4 cut(s) 236, 524, 603, 686
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.