Rh3CG013200
MYB Family

Transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0000402
Physical Location & Seq
Reverse (-)
883814 .. 885764
1951 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG013200.1

Sequence Viewer

Length: 321 bp
ATGATAAGCAGTCCTCTTGAGGATCAAACTTGCCAAGCCTTGGAAGAATGTAGCAAAGCATCAGTGGCAATGCTCTGCAATATTGATAAAGATCAGGGGCAGATCAGTCAGATAGTTGAGAGAGAGGATAGCAACAATCTATGTGTGGAAGAAGAACATGAGGGGAACAATGACTTCATGGGTGATTTGGGAATGGTAGACCTTGATCAATTTGAACAAGTTATAGAGCAATATGATCAAGAGTTCAACGACAAAAACAAGAAATGGGAGTGGGATGACTCCATCTTGGACATGGACCTTTGGGATACTGATTCTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

106

Amino Acids

12.26

Weight (kDa)

4.05

Isoelectric Point (pI)

51.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000402)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G56650 AT1G66370 AT1G66380 AT1G66380 AT1G66390
fragaria_vesca FvH4_1g22020 FvH4_1g22040 FvH4_5g34660 FvH4_5g34660 FvH4_6g01170
malus_domestica MD04G1235800.v1.1 MD05G1276500.v1.1 MD05G1276700.v1.1 MD09G1265100.v1.1 MD09G1278400.v1.1 MD09G1278600.v1.1 MD17G1261000.v1.1 MD17G1261100.v1.1
prunus_persica Prupe.3G163000_v2.0.a1 Prupe.3G163100_v2.0.a1 Prupe.3G163300_v2.0.a1 Prupe.6G176200_v2.0.a1 Prupe.6G176300_v2.0.a1 Prupe.6G355700_v2.0.a1
pyrus_communis pycom05g25770
rosa_chinensis RchiOBHm_Chr2g0116041 RchiOBHm_Chr2g0116071 RchiOBHm_Chr3g0448721 RchiOBHm_Chr3g0492711 RchiOBHm_Chr4g0415831 RchiOBHm_Chr4g0415891 RchiOBHm_Chr7g0235271
rosa_laevigata RLG00000001168 RLG00000008031 RLG00000008035 RLG00000018232 RLG00000018234 RLG00000025877
rosa_multiflora Rmu_sc0003147.1_g000006 Rmu_sc0003147.1_g000008 Rmu_sc0003147.1_g000018 Rmu_sc0004637.1_g000011 Rmu_sc0004657.1_g000064 Rmu_sc0013612.1_g000010 Rmu_sc0017810.1_g000002 Rmu_sc0027086.1_g000003
rosa_roxburghii Rroxscaffold_2G00127520 Rroxscaffold_2G00127530 Rroxscaffold_2G00127560 Rroxscaffold_2G00128380 Rroxscaffold_5G00359700 Rroxscaffold_5G00359730 Rroxscaffold_6G00392130
rosa_rugosa Rorug01G0050500 Rorug02G0202600 Rorug02G0202700 Rorug02G0202700 Rorug02G0202900 Rorug02G0203000 Rorug02G0616200 Rorug03G0256600 Rorug04G0137200 Rorug04G0247500
rosa_samantha Rh2AG259100 Rh2AG259200 Rh2BG270400 Rh2BG270700 Rh2BG270800 Rh2CG265700 Rh2CG265900 Rh2DG267400 Rh2DG267600 Rh3AG014400 Rh3AG069900 Rh3AG305900 Rh3BG014200 Rh3BG342300 Rh3CG013200 Rh3DG014800 Rh3DG341700 Rh4AG198700 Rh4AG199200 Rh4AG199500 Rh4BG197000 Rh4CG210100 Rh4DG196500 Rh4DG197000 Rh4DG197300 Rh7AG444500 Rh7DG433400
rosa_wichuraiana Rw0G010310 Rw2G020310 Rw2G020320 Rw2G020330 Rw3G001070 Rw3G026940 Rw4G016830 Rw4G016880 Rw4G016910 Rw7G036930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 40
AccI GTMKAC 1 cut(s) 198
AclWI GGATC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 2 cut(s) 215, 247
AlwI GGATC 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 295
AsuHPI GGTGA 1 cut(s) 194
AvaII GGWCC 1 cut(s) 295
BccI CCATC 1 cut(s) 290
BciVI GTATCC 1 cut(s) 298
BclI TGATCA 2 cut(s) 205, 235
BfuI GTATCC 1 cut(s) 298
Bme18I GGWCC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 295
BmsI GCATC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 38
BsaBI GATNNNNATC 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse3DI GCAATG 1 cut(s) 75
Bse8I GATNNNNATC 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 1 cut(s) 280
BseJI GATNNNNATC 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMI GCAATG 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 40
Bsp143I GATC 5 cut(s) 22, 91, 102, 205, 235
BspPI GGATC 1 cut(s) 30
BsrDI GCAATG 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 5 cut(s) 22, 91, 102, 205, 235
BssT1I CCWWGG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 280
BstKTI GATC 5 cut(s) 25, 94, 105, 208, 238
BstMBI GATC 5 cut(s) 22, 91, 102, 205, 235
BstMWI GCNNNNNNNGC 1 cut(s) 65
BsuI GTATCC 1 cut(s) 298
BtsCI GGATG 1 cut(s) 280
BtsIMutI CAGTG 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 295
CviAII CATG 3 cut(s) 158, 178, 292
CviJI RGCY 1 cut(s) 38
CviKI_1 RGCY 1 cut(s) 38
DpnI GATC 5 cut(s) 24, 93, 104, 207, 237
DpnII GATC 5 cut(s) 22, 91, 102, 205, 235
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 295
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 3 cut(s) 161, 181, 295
FaiI YATR 7 cut(s) 142, 159, 179, 224, 234, 293, 319
FatI CATG 3 cut(s) 157, 177, 291
FbaI TGATCA 2 cut(s) 205, 235
FblI GTMKAC 1 cut(s) 198
FokI GGATG 1 cut(s) 287
Hin1II CATG 3 cut(s) 161, 181, 295
HinfI GANTC 2 cut(s) 278, 311
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 2 cut(s) 17, 239
Hpy8I GTNNAC 1 cut(s) 199
HpyCH4V TGCA 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Hsp92II CATG 3 cut(s) 161, 181, 295
Ksp22I TGATCA 2 cut(s) 205, 235
Kzo9I GATC 5 cut(s) 22, 91, 102, 205, 235
LpnPI CCDG 1 cut(s) 80
LweI GCATC 1 cut(s) 68
MalI GATC 5 cut(s) 24, 93, 104, 207, 237
MboI GATC 5 cut(s) 22, 91, 102, 205, 235
MboII GAAGA 4 cut(s) 56, 161, 164, 306
MluCI AATT 1 cut(s) 209
MlyI GAGTC 1 cut(s) 272
MnlI CCTC 4 cut(s) 13, 24, 118, 154
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 5 cut(s) 22, 91, 102, 205, 235
NlaIII CATG 3 cut(s) 161, 181, 295
PfeI GAWTC 1 cut(s) 311
PflMI CCANNNNNTGG 1 cut(s) 40
PleI GAGTC 1 cut(s) 272
PpsI GAGTC 1 cut(s) 272
PspPI GGNCC 1 cut(s) 295
Sau3AI GATC 5 cut(s) 22, 91, 102, 205, 235
Sau96I GGNCC 1 cut(s) 295
SchI GAGTC 1 cut(s) 272
SetI ASST 2 cut(s) 204, 300
SfaNI GCATC 1 cut(s) 68
SinI GGWCC 1 cut(s) 295
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 1 cut(s) 209
SspI AATATT 1 cut(s) 82
StyI CCWWGG 1 cut(s) 39
TasI AATT 1 cut(s) 209
TfiI GAWTC 1 cut(s) 311
TscAI CASTG 1 cut(s) 69
TspDTI ATGAA 2 cut(s) 166, 306
TspRI CASTG 1 cut(s) 69
Van91I CCANNNNNTGG 1 cut(s) 40
VpaK11BI GGWCC 1 cut(s) 295
XcmI CCANNNNNNNNNTGG 1 cut(s) 289
XmiI GTMKAC 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.