Rmu_sc0036735.1_g000002

metalloendoproteinase 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036735.1
Physical Location & Seq
Reverse (-)
2274 .. 2613
340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036735.1_g000002.1.cds

Sequence Viewer

Length: 340 bp
gtcccaaagttacgagaatgcggatttgaagattagttttcataagggtgatcatggagaccggaattcatttgatggccccggtggggtcctagcccatgcgtttagcccgtcggatggaagattccactacgacgcagatgagacttggtctgtgggtgctactccgggtgctatggacttggagagtgtggctttgcatgaaatagggcaccttctgggacttggacatagctcagtggagggagctatcatggccccagttattccctcgggagtggctcgaataagtttgactggggacgatgttcaaggaataagggctttatacaacgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

11.74

Weight (kDa)

4.91

Isoelectric Point (pI)

31.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000309)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g07510 FvH4_6g49990 FvH4_6g50000 FvH4_6g50010
malus_domestica MD04G1045600.v1.1 MD09G1040300.v1.1 MD09G1040400.v1.1 MD09G1040500.v1.1
prunus_persica Prupe.1G198800_v2.0.a1 Prupe.3G277800_v2.0.a1 Prupe.3G278000_v2.0.a1
pyrus_communis pycom17g03670 pycom17g03680 pycom17g03720 pycom17g03730
rosa_chinensis RchiOBHm_Chr2g0170151 RchiOBHm_Chr2g0170161 RchiOBHm_Chr2g0170221 RchiOBHm_Chr2g0170241 RchiOBHm_Chr2g0170251 RchiOBHm_Chr2g0171951 RchiOBHm_Chr4g0400091 RchiOBHm_Chr7g0222561 RchiOBHm_Chr7g0222571
rosa_laevigata RLG00000009215 RLG00000021923 RLG00000021924 RLG00000021929 RLG00000021930 RLG00000021931 RLG00000021932 RLG00000021936 RLG00000021937 RLG00000021938 RLG00000021940 RLG00000021941 RLG00000029406 RLG00000029407
rosa_multiflora Rmu_co8411991.1_g000001 Rmu_co8418277.1_g000001 Rmu_co8459115.1_g000001 Rmu_sc0000037.1_g000004 Rmu_sc0001605.1_g000012 Rmu_sc0001605.1_g000013 Rmu_sc0001605.1_g000018 Rmu_sc0001605.1_g000019 Rmu_sc0012468.1_g000004 Rmu_sc0012468.1_g000011 Rmu_sc0012468.1_g000017 Rmu_sc0012468.1_g000019 Rmu_sc0012468.1_g000026 Rmu_sc0036734.1_g000001 Rmu_sc0036734.1_g000002 Rmu_sc0036735.1_g000001 Rmu_sc0036735.1_g000002
rosa_roxburghii Rroxscaffold_2G00081470 Rroxscaffold_2G00081540 Rroxscaffold_2G00081550 Rroxscaffold_3G00236660 Rroxscaffold_5G00345030 Rroxscaffold_5G00345060
rosa_rugosa Rorug02G0546300 Rorug02G0546800 Rorug02G0546800 Rorug02G0546800 Rorug02G0546900 Rorug02G0547000.1 Rorug02G0547100 Rorug02G0547300 Rorug04G0022500 Rorug07G0210800 Rorug07G0210900
rosa_samantha Rh2AG618400 Rh2AG618700 Rh2AG618800 Rh2AG619000 Rh2AG619100 Rh2AG631500 Rh2AG631600 Rh2BG630000 Rh2BG644800 Rh2BG644900 Rh2CG599400 Rh2CG599500 Rh2CG599600 Rh2CG599700 Rh2DG642000 Rh2DG642200 Rh2DG642300 Rh2DG642400 Rh2DG642500 Rh2DG642800 Rh2DG642900 Rh4AG098000 Rh4BG096300 Rh4CG107400 Rh4DG092900 Rh7AG354000 Rh7AG354100 Rh7AG354500 Rh7AG354700 Rh7BG342900 Rh7CG371500 Rh7CG371600 Rh7DG349300 Rh7DG349400
rosa_wichuraiana Rw0G015130 Rw0G018360 Rw0G018370 Rw2G051210 Rw2G051220 Rw2G051230 Rw2G051240 Rw2G051260 Rw2G051270 Rw4G008170 Rw7G029780 Rw7G030120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 211
AciI CCGC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 65
AfiI CCNNNNNNNGG 2 cut(s) 86, 117
AgsI TTSAA 2 cut(s) 29, 312
AluBI AGCT 2 cut(s) 235, 249
AluI AGCT 2 cut(s) 235, 249
Alw26I GTCTC 2 cut(s) 52, 138
Ama87I CYCGRG 1 cut(s) 272
AoxI GGCC 2 cut(s) 77, 256
ApoI RAATTY 1 cut(s) 65
AspS9I GGNCC 3 cut(s) 78, 89, 257
AsuC2I CCSGG 2 cut(s) 82, 169
AsuHPI GGTGA 1 cut(s) 60
AvaI CYCGRG 1 cut(s) 272
AvaII GGWCC 1 cut(s) 89
BaeGI GKGCMC 1 cut(s) 214
BanI GGYRCC 1 cut(s) 211
BccI CCATC 2 cut(s) 69, 111
BclI TGATCA 1 cut(s) 50
BcnI CCSGG 2 cut(s) 82, 169
BcoDI GTCTC 2 cut(s) 52, 138
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 2 cut(s) 82, 169
Bme18I GGWCC 1 cut(s) 89
BmeT110I CYCGRG 1 cut(s) 272
BmgT120I GGNCC 3 cut(s) 78, 89, 257
BmiI GGNNCC 4 cut(s) 80, 90, 213, 259
BmrFI CCNGG 2 cut(s) 82, 169
BmrI ACTGGG 2 cut(s) 255, 307
BmuI ACTGGG 2 cut(s) 255, 307
BpuMI CCSGG 2 cut(s) 82, 169
BsaI GGTCTC 1 cut(s) 52
BsaJI CCNNGG 2 cut(s) 80, 271
BsaWI WCCGGW 1 cut(s) 61
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 117
Bse1I ACTGG 2 cut(s) 261, 302
BseDI CCNNGG 2 cut(s) 80, 271
BseGI GGATG 1 cut(s) 122
BseLI CCNNNNNNNGG 2 cut(s) 86, 117
BseMII CTCAG 1 cut(s) 250
BseNI ACTGG 2 cut(s) 261, 302
BseSI GKGCMC 1 cut(s) 214
BshFI GGCC 2 cut(s) 79, 258
BshNI GGYRCC 1 cut(s) 211
BsiHKCI CYCGRG 1 cut(s) 272
BsiSI CCGG 3 cut(s) 62, 82, 168
BslFI GGGAC 2 cut(s) 235, 315
BslI CCNNNNNNNGG 2 cut(s) 86, 117
BsmAI GTCTC 2 cut(s) 52, 138
BsmFI GGGAC 2 cut(s) 235, 315
BsmI GAATGC 1 cut(s) 23
BsnI GGCC 2 cut(s) 79, 258
Bso31I GGTCTC 1 cut(s) 52
BsoBI CYCGRG 1 cut(s) 272
Bsp1286I GDGCHC 1 cut(s) 214
Bsp143I GATC 1 cut(s) 50
BspACI CCGC 1 cut(s) 21
BspANI GGCC 2 cut(s) 79, 258
BspCNI CTCAG 1 cut(s) 249
BspLI GGNNCC 4 cut(s) 80, 90, 213, 259
BspT107I GGYRCC 1 cut(s) 211
BspTNI GGTCTC 1 cut(s) 52
BsrI ACTGG 2 cut(s) 261, 302
BssECI CCNNGG 2 cut(s) 80, 271
BssMI GATC 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 236
BstF5I GGATG 1 cut(s) 122
BstKTI GATC 1 cut(s) 53
BstMAI GTCTC 2 cut(s) 52, 138
BstMBI GATC 1 cut(s) 50
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstSCI CCNGG 2 cut(s) 80, 167
BstSLI GKGCMC 1 cut(s) 214
BsuRI GGCC 2 cut(s) 79, 258
BtsCI GGATG 1 cut(s) 122
BtsIMutI CAGTG 1 cut(s) 244
Cfr13I GGNCC 3 cut(s) 78, 89, 257
CseI GACGC 1 cut(s) 144
CviAII CATG 4 cut(s) 54, 99, 201, 254
CviJI RGCY 9 cut(s) 79, 96, 109, 195, 235, 249, 258, 282, 324
CviKI_1 RGCY 9 cut(s) 79, 96, 109, 195, 235, 249, 258, 282, 324
DdeI CTNAG 1 cut(s) 236
DpnI GATC 1 cut(s) 52
DpnII GATC 1 cut(s) 50
Eco31I GGTCTC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 89
Eco88I CYCGRG 1 cut(s) 272
EcoO109I RGGNCCY 1 cut(s) 89
EcoRI GAATTC 1 cut(s) 65
FaeI CATG 4 cut(s) 57, 102, 204, 257
FaiI YATR 8 cut(s) 43, 55, 100, 177, 202, 232, 255, 329
FaqI GGGAC 2 cut(s) 235, 315
FatI CATG 4 cut(s) 53, 98, 200, 253
FbaI TGATCA 1 cut(s) 50
FokI GGATG 1 cut(s) 129
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 2 cut(s) 79, 258
HapII CCGG 3 cut(s) 62, 82, 168
HgaI GACGC 1 cut(s) 144
Hin1II CATG 4 cut(s) 57, 102, 204, 257
HinfI GANTC 1 cut(s) 124
HpaII CCGG 3 cut(s) 62, 82, 168
HphI GGTGA 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 116, 339
Hpy188III TCNNGA 1 cut(s) 274
Hpy99I CGWCG 2 cut(s) 116, 138
HpyAV CCTTC 1 cut(s) 225
HpyCH4IV ACGT 1 cut(s) 334
HpyCH4V TGCA 1 cut(s) 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
HpyF3I CTNAG 1 cut(s) 236
HpySE526I ACGT 1 cut(s) 334
Hsp92II CATG 4 cut(s) 57, 102, 204, 257
Ksp22I TGATCA 1 cut(s) 50
Kzo9I GATC 1 cut(s) 50
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 6 cut(s) 75, 95, 181, 204, 274, 283
MaeI CTAG 1 cut(s) 93
MaeII ACGT 1 cut(s) 334
MaeIII GTNAC 1 cut(s) 9
MalI GATC 1 cut(s) 52
MboI GATC 1 cut(s) 50
MboII GAAGA 2 cut(s) 41, 133
MhlI GDGCHC 1 cut(s) 214
MluCI AATT 1 cut(s) 65
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 2 cut(s) 236, 281
MslI CAYNNNNRTG 1 cut(s) 46
MspI CCGG 3 cut(s) 62, 82, 168
MspR9I CCNGG 2 cut(s) 82, 169
Mva1269I GAATGC 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 255
NciI CCSGG 2 cut(s) 82, 169
NdeII GATC 1 cut(s) 50
NlaIII CATG 4 cut(s) 57, 102, 204, 257
NlaIV GGNNCC 4 cut(s) 80, 90, 213, 259
PctI GAATGC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 124
PflFI GACNNNGTC 1 cut(s) 149
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
PspN4I GGNNCC 4 cut(s) 80, 90, 213, 259
PspPI GGNCC 3 cut(s) 78, 89, 257
PspPPI RGGWCCY 1 cut(s) 89
PsyI GACNNNGTC 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 46
Sau3AI GATC 1 cut(s) 50
Sau96I GGNCC 3 cut(s) 78, 89, 257
ScrFI CCNGG 2 cut(s) 82, 169
SduI GDGCHC 1 cut(s) 214
SetI ASST 4 cut(s) 217, 237, 251, 337
SinI GGWCC 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 46
Sse9I AATT 1 cut(s) 65
SsiI CCGC 1 cut(s) 21
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 2 cut(s) 80, 167
TaiI ACGT 1 cut(s) 337
TaqI TCGA 1 cut(s) 284
TasI AATT 1 cut(s) 65
TfiI GAWTC 1 cut(s) 124
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 3 cut(s) 30, 58, 217
TspRI CASTG 1 cut(s) 244
Tth111I GACNNNGTC 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 65
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.