Rroxscaffold_3G00220040

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
2229441 .. 2230521
1081 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00220040.1

Sequence Viewer

Length: 162 bp
ATGGAGATGAAGAGGGACTACTCTGGCTGGTTTATCAAGTACAGTGGTGATTTTCATCCCATGTATTCCGAGATGGTTAGGGACTATCCTAGCCTTGTTCATCCTCATATTATCTACACAAACACCATATACAAGCAAGACAGATTTAAAAGAGATAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.58

Weight (kDa)

8.04

Isoelectric Point (pI)

42.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000449)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g12890 FvH4_4g01370 FvH4_4g01420 FvH4_4g01430 FvH4_4g01472 FvH4_4g01490 FvH4_6g31140 FvH4_6g31150 FvH4_6g31161 FvH4_6g43941 FvH4_6g43961
rosa_chinensis RchiOBHm_Chr4g0387951 RchiOBHm_Chr4g0388001 RchiOBHm_Chr4g0388011 RchiOBHm_Chr4g0388051 RchiOBHm_Chr4g0388631 RchiOBHm_Chr4g0388641 RchiOBHm_Chr4g0388661 RchiOBHm_Chr4g0388801
rosa_laevigata RLG00000010028 RLG00000010030 RLG00000010032 RLG00000010082 RLG00000010086 RLG00000010089 RLG00000010091 RLG00000014277
rosa_multiflora Rmu_co8138914.1_g000001 Rmu_sc0000697.1_g000015 Rmu_sc0002180.1_g000030 Rmu_sc0002509.1_g000011 Rmu_sc0002509.1_g000012 Rmu_sc0002509.1_g000020 Rmu_sc0002509.1_g000021 Rmu_sc0004459.1_g000003 Rmu_sc0004459.1_g000005 Rmu_sc0006767.1_g000007 Rmu_sc0014755.1_g000003 Rmu_sc0014755.1_g000004 Rmu_sc0036097.1_g000001
rosa_roxburghii Rroxscaffold_2G00089440 Rroxscaffold_3G00220040 Rroxscaffold_5G00334500 Rroxscaffold_5G00334530 Rroxscaffold_5G00334540 Rroxscaffold_5G00335080
rosa_rugosa Rorug02G0485300 Rorug03G0314100 Rorug03G0314200 Rorug03G0314500 Rorug03G0314500 Rorug03G0314600 Rorug03G0319800 Rorug03G0319900 Rorug03G0320000 Rorug06G0011400
rosa_samantha Rh4AG019700 Rh4AG019900 Rh4AG020200 Rh4AG023900 Rh4AG024000 Rh4AG024700 Rh4BG013900 Rh4BG014100 Rh4BG014200 Rh4BG014300 Rh4BG014400 Rh4BG014500 Rh4BG014600 Rh4BG014700 Rh4BG017100 Rh4BG017400 Rh4BG017500 Rh4BG017600 Rh4BG017700 Rh4BG089200 Rh4DG014500 Rh4DG014800 Rh4DG014900 Rh4DG015400 Rh4DG017900 Rh4DG018000 Rh6BG127900 Rh6CG126300 Rh6DG113400
rosa_wichuraiana Rw4G001270 Rw4G001320 Rw4G001350 Rw4G001700 Rw4G001710 Rw4G001720 Rw4G001760 Rw6G011430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 41
AluBI AGCT 1 cut(s) 159
AluI AGCT 1 cut(s) 159
AsuHPI GGTGA 1 cut(s) 59
BarI GAAGNNNNNNTAC 1 cut(s) 34
BccI CCATC 1 cut(s) 67
BfaI CTAG 1 cut(s) 90
BsaBI GATNNNNATC 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 54
BseGI GGATG 2 cut(s) 55, 100
BseJI GATNNNNATC 1 cut(s) 54
BslFI GGGAC 2 cut(s) 29, 95
BsmFI GGGAC 2 cut(s) 29, 95
Bst4CI ACNGT 1 cut(s) 44
Bst6I CTCTTC 1 cut(s) 5
BstF5I GGATG 2 cut(s) 55, 100
BtsCI GGATG 2 cut(s) 55, 100
BtsIMutI CAGTG 1 cut(s) 49
Csp6I GTAC 1 cut(s) 40
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 1 cut(s) 61
CviJI RGCY 3 cut(s) 27, 93, 159
CviKI_1 RGCY 3 cut(s) 27, 93, 159
CviQI GTAC 1 cut(s) 40
DraI TTTAAA 1 cut(s) 148
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
FaeI CATG 1 cut(s) 64
FaiI YATR 4 cut(s) 62, 108, 128, 130
FaqI GGGAC 2 cut(s) 29, 95
FatI CATG 1 cut(s) 60
FokI GGATG 2 cut(s) 42, 87
FspBI CTAG 1 cut(s) 90
Hin1II CATG 1 cut(s) 64
HphI GGTGA 1 cut(s) 59
Hpy188I TCNGA 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 44
Hsp92II CATG 1 cut(s) 64
LpnPI CCDG 2 cut(s) 9, 13
MaeI CTAG 1 cut(s) 90
MboII GAAGA 1 cut(s) 22
MnlI CCTC 2 cut(s) 6, 114
MseI TTAA 1 cut(s) 147
NlaIII CATG 1 cut(s) 64
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 1 cut(s) 147
SetI ASST 1 cut(s) 161
SgeI CNNG 9 cut(s) 36, 40, 49, 73, 82, 102, 107, 145, 149
SspMI CTAG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 44
TatI WGTACW 1 cut(s) 39
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 49
TspDTI ATGAA 3 cut(s) 23, 44, 89
TspRI CASTG 1 cut(s) 49
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.