AT2G04830

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0000658
Physical Location & Seq
Forward (+)
1695355 .. 1695856
502 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G04830.1

Sequence Viewer

Length: 303 bp
ATGAATCTTGAGAGTTACAAGTGGGAAAGAGTTTACTCTATTGGAGATGAGATGTTGATTTTTGGTCGTGGGGTTACAGTACCTCTCGCTCTTAAAGATCTTGGTCACGGAATCAAGAGTGATTCAATCTATTTCGTCGACGACGAAGATGTTTGGCCAGATCATAAAGATTGGCCAGATTATAAAGATCATGTATCGAATTGCGGTGTCTTCGATATTGCCACAAGTAAGATCGAATGGCCTAAGAAGATCTATTTTTCCGTTAATAAAACTCAGTGGTTTGTTTGGGGAGTTGCTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box

Protein Analysis

100

Amino Acids

11.74

Weight (kDa)

4.99

Isoelectric Point (pI)

13.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_KIB1-4 PF03478 1 - 72 4.6e-11 KIB1-4 beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 183
AccI GTMKAC 1 cut(s) 138
AciI CCGC 1 cut(s) 204
AcoI YGGCCR 2 cut(s) 155, 173
AfaI GTAC 1 cut(s) 81
AgsI TTSAA 1 cut(s) 126
AoxI GGCC 3 cut(s) 155, 173, 239
BalI TGGCCA 2 cut(s) 157, 175
BbsI GAAGAC 1 cut(s) 202
BglII AGATCT 2 cut(s) 97, 249
BpiI GAAGAC 1 cut(s) 202
BpuEI CTTGAG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 287
BshFI GGCC 3 cut(s) 157, 175, 241
BsnI GGCC 3 cut(s) 157, 175, 241
Bsp143I GATC 5 cut(s) 97, 160, 187, 231, 249
BspACI CCGC 1 cut(s) 204
BspANI GGCC 3 cut(s) 157, 175, 241
BspCNI CTCAG 1 cut(s) 286
BssMI GATC 5 cut(s) 97, 160, 187, 231, 249
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 2 cut(s) 243, 273
BstKTI GATC 5 cut(s) 100, 163, 190, 234, 252
BstMBI GATC 5 cut(s) 97, 160, 187, 231, 249
BstV2I GAAGAC 1 cut(s) 202
BstX2I RGATCY 2 cut(s) 97, 249
BstYI RGATCY 2 cut(s) 97, 249
BsuRI GGCC 3 cut(s) 157, 175, 241
BtsIMutI CAGTG 1 cut(s) 281
Csp6I GTAC 1 cut(s) 80
CviAII CATG 1 cut(s) 191
CviJI RGCY 3 cut(s) 157, 175, 241
CviKI_1 RGCY 3 cut(s) 157, 175, 241
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 2 cut(s) 243, 273
DpnI GATC 5 cut(s) 99, 162, 189, 233, 251
DpnII GATC 5 cut(s) 97, 160, 187, 231, 249
EaeI YGGCCR 2 cut(s) 155, 173
FaeI CATG 1 cut(s) 194
FaiI YATR 3 cut(s) 165, 183, 192
FatI CATG 1 cut(s) 190
FblI GTMKAC 1 cut(s) 138
HaeIII GGCC 3 cut(s) 157, 175, 241
Hin1II CATG 1 cut(s) 194
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 3 cut(s) 4, 111, 122
Hpy166II GTNNAC 2 cut(s) 34, 139
Hpy188III TCNNGA 2 cut(s) 8, 115
Hpy8I GTNNAC 2 cut(s) 34, 139
Hpy99I CGWCG 3 cut(s) 140, 143, 146
HpyCH4III ACNGT 1 cut(s) 79
HpyF3I CTNAG 2 cut(s) 243, 273
Hsp92II CATG 1 cut(s) 194
Kzo9I GATC 5 cut(s) 97, 160, 187, 231, 249
LpnPI CCDG 2 cut(s) 171, 189
MaeIII GTNAC 3 cut(s) 14, 73, 104
MalI GATC 5 cut(s) 99, 162, 189, 233, 251
MboI GATC 5 cut(s) 97, 160, 187, 231, 249
MboII GAAGA 3 cut(s) 158, 202, 259
MflI RGATCY 2 cut(s) 97, 249
MlsI TGGCCA 2 cut(s) 157, 175
MluCI AATT 1 cut(s) 199
MluNI TGGCCA 2 cut(s) 157, 175
MnlI CCTC 1 cut(s) 93
Mox20I TGGCCA 2 cut(s) 157, 175
MscI TGGCCA 2 cut(s) 157, 175
MseI TTAA 2 cut(s) 93, 264
Msp20I TGGCCA 2 cut(s) 157, 175
NdeII GATC 5 cut(s) 97, 160, 187, 231, 249
NlaIII CATG 1 cut(s) 194
NmuCI GTSAC 1 cut(s) 104
PcsI WCGNNNNNNNCGW 1 cut(s) 141
PfeI GAWTC 3 cut(s) 4, 111, 122
PsiI TTATAA 1 cut(s) 183
PsuI RGATCY 2 cut(s) 97, 249
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SalI GTCGAC 1 cut(s) 137
SaqAI TTAA 2 cut(s) 93, 264
Sau3AI GATC 5 cut(s) 97, 160, 187, 231, 249
SetI ASST 1 cut(s) 85
SgrDI CGTCGACG 1 cut(s) 137
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
Sse9I AATT 1 cut(s) 199
SsiI CCGC 1 cut(s) 204
TaaI ACNGT 1 cut(s) 79
TaqI TCGA 4 cut(s) 138, 197, 213, 234
TasI AATT 1 cut(s) 199
TfiI GAWTC 3 cut(s) 4, 111, 122
Tru1I TTAA 2 cut(s) 93, 264
Tru9I TTAA 2 cut(s) 93, 264
TscAI CASTG 1 cut(s) 281
TseFI GTSAC 1 cut(s) 104
Tsp45I GTSAC 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 123, 250
TspRI CASTG 1 cut(s) 281
XmiI GTMKAC 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.