AT4G22035

Protein of unknown function (DUF295)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0000658
Physical Location & Seq
Forward (+)
11674333 .. 11675463
1131 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G22035.1

Sequence Viewer

Length: 732 bp
ATGAACTATCCCTCTCCAAGGTTTGATGGATCAAGCTGGTCCAAGCTTCCTTCAGATCTTCTGAATATGGTTTTTGAACGTCTTGGGTTTGCAGATTTTCAACGAGCTAAATCCGTTTGTCCATCTTGGCTAGATGCTTCAAGACAATCAGCGTCAAAAAATCAGATCCCTTGGCTGATCATGTTTCCAGAAAAAGGTAAAGACTATTGTCTCTTGTTTAATTCTGAAGAAAAGGAGAAAGCCTATAGAATTAAAGATCTTGGTGTTGAATTCGCAAATAGTCATTGTTTGGCGATATATGGAAGTTGGCTCTTTATGCGAGATTCTAGATATAATCTCTATGTTATGAATCTATTTACTCGCGAGAGGATTAATTTTCCATCTGTGGAGTCACAATTTGAAATCGATGACGAATATGATGTTGAATATCCTGAAAGACACATCAATATTGACTTCCCTTTATTATGGATAGACGATATAACCAAACATTACGTGGTTATATGGTCAATCCAATACCGCCAATACCAATATCTAGTTTATTATAGGAAAGGAGATAATTGGTTGAAACATGCTACTTACTGTAGTTTTGATATGGTAGGCATTGTTGACATGGTATACAAAGATCATAAGATTTACTTGTATAGTACAACTAGTGATGTCAAAGTGTTGGAATTTTTTGGAGATATTCTTTTTGATAGGATTTTTTGGAGATATTCCGCGACAAATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box

Protein Analysis

243

Amino Acids

29.22

Weight (kDa)

5.58

Isoelectric Point (pI)

34.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 13 - 50 1.1e-07 F-box domain
Beta-prop_KIB1-4 PF03478 73 - 228 2.6e-24 KIB1-4 beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 615
AccII CGCG 2 cut(s) 363, 719
AciI CCGC 2 cut(s) 517, 717
AclWI GGATC 2 cut(s) 37, 160
AcsI RAATTY 2 cut(s) 269, 671
AcuI CTGAAG 2 cut(s) 36, 246
AfaI GTAC 1 cut(s) 646
AfiI CCNNNNNNNGG 2 cut(s) 18, 194
AgsI TTSAA 7 cut(s) 77, 101, 141, 269, 401, 425, 565
AhlI ACTAGT 1 cut(s) 650
AluBI AGCT 3 cut(s) 36, 46, 107
AluI AGCT 3 cut(s) 36, 46, 107
Alw26I GTCTC 1 cut(s) 215
AlwI GGATC 2 cut(s) 37, 160
ApoI RAATTY 2 cut(s) 269, 671
AseI ATTAAT 1 cut(s) 372
AspS9I GGNCC 1 cut(s) 39
AvaII GGWCC 1 cut(s) 39
BccI CCATC 3 cut(s) 20, 130, 388
BclI TGATCA 1 cut(s) 177
BcoDI GTCTC 1 cut(s) 215
BcuI ACTAGT 1 cut(s) 650
BfaI CTAG 4 cut(s) 131, 327, 533, 651
BfmI CTRYAG 2 cut(s) 244, 580
BglII AGATCT 2 cut(s) 55, 256
Bme18I GGWCC 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 39
BmsI GCATC 1 cut(s) 124
BoxI GACNNNNGTC 1 cut(s) 207
Bsa29I ATCGAT 1 cut(s) 405
BsaAI YACGTR 1 cut(s) 493
BsaJI CCNNGG 2 cut(s) 17, 170
Bsc4I CCNNNNNNNGG 2 cut(s) 18, 194
BseCI ATCGAT 1 cut(s) 405
BseDI CCNNGG 2 cut(s) 17, 170
BseLI CCNNNNNNNGG 2 cut(s) 18, 194
Bsh1236I CGCG 2 cut(s) 363, 719
BshVI ATCGAT 1 cut(s) 405
BslI CCNNNNNNNGG 2 cut(s) 18, 194
BsmAI GTCTC 1 cut(s) 215
Bsp143I GATC 6 cut(s) 29, 55, 165, 177, 256, 622
Bsp68I TCGCGA 1 cut(s) 363
BspACI CCGC 2 cut(s) 517, 717
BspDI ATCGAT 1 cut(s) 405
BspFNI CGCG 2 cut(s) 363, 719
BspPI GGATC 2 cut(s) 37, 160
BssECI CCNNGG 2 cut(s) 17, 170
BssMI GATC 6 cut(s) 29, 55, 165, 177, 256, 622
BssNAI GTATAC 1 cut(s) 616
BssT1I CCWWGG 2 cut(s) 17, 170
Bst1107I GTATAC 1 cut(s) 616
Bst4CI ACNGT 1 cut(s) 581
BstBAI YACGTR 1 cut(s) 493
BstENI CCTNNNNNAGG 1 cut(s) 16
BstFNI CGCG 2 cut(s) 363, 719
BstKTI GATC 6 cut(s) 32, 58, 168, 180, 259, 625
BstMAI GTCTC 1 cut(s) 215
BstMBI GATC 6 cut(s) 29, 55, 165, 177, 256, 622
BstMWI GCNNNNNNNGC 1 cut(s) 316
BstNSI RCATGY 1 cut(s) 572
BstPAI GACNNNNGTC 1 cut(s) 207
BstSFI CTRYAG 2 cut(s) 244, 580
BstUI CGCG 2 cut(s) 363, 719
BstX2I RGATCY 3 cut(s) 55, 165, 256
BstYI RGATCY 3 cut(s) 55, 165, 256
BstZ17I GTATAC 1 cut(s) 616
Bsu15I ATCGAT 1 cut(s) 405
BsuTUI ATCGAT 1 cut(s) 405
BtuMI TCGCGA 1 cut(s) 363
Cfr13I GGNCC 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 405
CseI GACGC 1 cut(s) 141
Csp6I GTAC 1 cut(s) 645
CviAII CATG 3 cut(s) 181, 569, 610
CviJI RGCY 7 cut(s) 36, 46, 107, 130, 175, 242, 310
CviKI_1 RGCY 7 cut(s) 36, 46, 107, 130, 175, 242, 310
CviQI GTAC 1 cut(s) 645
DpnI GATC 6 cut(s) 31, 57, 167, 179, 258, 624
DpnII GATC 6 cut(s) 29, 55, 165, 177, 256, 622
Eco130I CCWWGG 2 cut(s) 17, 170
Eco47I GGWCC 1 cut(s) 39
Eco57I CTGAAG 2 cut(s) 36, 246
EcoNI CCTNNNNNAGG 1 cut(s) 16
EcoRI GAATTC 1 cut(s) 269
EcoT14I CCWWGG 2 cut(s) 17, 170
ErhI CCWWGG 2 cut(s) 17, 170
FaeI CATG 3 cut(s) 184, 572, 613
FalI AAGNNNNNCTT 2 cut(s) 620, 652
FatI CATG 3 cut(s) 180, 568, 609
FbaI TGATCA 1 cut(s) 177
FblI GTMKAC 1 cut(s) 615
FspBI CTAG 4 cut(s) 131, 327, 533, 651
HgaI GACGC 1 cut(s) 141
Hin1II CATG 3 cut(s) 184, 572, 613
HincII GTYRAC 1 cut(s) 607
HindII GTYRAC 1 cut(s) 607
HindIII AAGCTT 1 cut(s) 44
HinfI GANTC 3 cut(s) 323, 349, 389
Hpy166II GTNNAC 2 cut(s) 607, 616
Hpy188I TCNGA 4 cut(s) 55, 63, 165, 226
Hpy188III TCNNGA 5 cut(s) 141, 188, 327, 362, 431
Hpy8I GTNNAC 2 cut(s) 607, 616
HpyAV CCTTC 1 cut(s) 60
HpyCH4III ACNGT 1 cut(s) 581
HpyCH4IV ACGT 2 cut(s) 79, 492
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 316
HpySE526I ACGT 2 cut(s) 79, 492
Hsp92II CATG 3 cut(s) 184, 572, 613
Ksp22I TGATCA 1 cut(s) 177
Kzo9I GATC 6 cut(s) 29, 55, 165, 177, 256, 622
LpnPI CCDG 3 cut(s) 22, 201, 444
LweI GCATC 1 cut(s) 124
MaeI CTAG 4 cut(s) 131, 327, 533, 651
MaeII ACGT 2 cut(s) 79, 492
MaeIII GTNAC 1 cut(s) 390
MalI GATC 6 cut(s) 31, 57, 167, 179, 258, 624
MboI GATC 6 cut(s) 29, 55, 165, 177, 256, 622
MboII GAAGA 2 cut(s) 50, 239
MflI RGATCY 3 cut(s) 55, 165, 256
MluCI AATT 7 cut(s) 220, 249, 269, 373, 395, 556, 671
MlyI GAGTC 1 cut(s) 398
MmeI TCCRAC 1 cut(s) 648
MnlI CCTC 2 cut(s) 22, 360
MseI TTAA 3 cut(s) 219, 252, 372
MvnI CGCG 2 cut(s) 363, 719
MwoI GCNNNNNNNGC 1 cut(s) 316
NdeII GATC 6 cut(s) 29, 55, 165, 177, 256, 622
NlaIII CATG 3 cut(s) 184, 572, 613
NmuCI GTSAC 1 cut(s) 390
NruI TCGCGA 1 cut(s) 363
NspI RCATGY 1 cut(s) 572
PfeI GAWTC 2 cut(s) 323, 349
PleI GAGTC 1 cut(s) 397
PpsI GAGTC 1 cut(s) 397
Ppu21I YACGTR 1 cut(s) 493
PshAI GACNNNNGTC 1 cut(s) 207
PshBI ATTAAT 1 cut(s) 372
PspPI GGNCC 1 cut(s) 39
PsuI RGATCY 3 cut(s) 55, 165, 256
RruI TCGCGA 1 cut(s) 363
RsaI GTAC 1 cut(s) 646
RsaNI GTAC 1 cut(s) 645
SaqAI TTAA 3 cut(s) 219, 252, 372
Sau3AI GATC 6 cut(s) 29, 55, 165, 177, 256, 622
Sau96I GGNCC 1 cut(s) 39
SchI GAGTC 1 cut(s) 398
SetI ASST 7 cut(s) 23, 38, 48, 82, 109, 199, 495
SfaNI GCATC 1 cut(s) 124
SfcI CTRYAG 2 cut(s) 244, 580
SinI GGWCC 1 cut(s) 39
SpeI ACTAGT 1 cut(s) 650
Sse9I AATT 7 cut(s) 220, 249, 269, 373, 395, 556, 671
SsiI CCGC 2 cut(s) 517, 717
SspI AATATT 1 cut(s) 448
SspMI CTAG 4 cut(s) 131, 327, 533, 651
StyI CCWWGG 2 cut(s) 17, 170
TaaI ACNGT 1 cut(s) 581
TaiI ACGT 2 cut(s) 82, 495
TaqI TCGA 1 cut(s) 405
TasI AATT 7 cut(s) 220, 249, 269, 373, 395, 556, 671
TatI WGTACW 1 cut(s) 644
TfiI GAWTC 2 cut(s) 323, 349
Tru1I TTAA 3 cut(s) 219, 252, 372
Tru9I TTAA 3 cut(s) 219, 252, 372
TseFI GTSAC 1 cut(s) 390
Tsp45I GTSAC 1 cut(s) 390
TspDTI ATGAA 2 cut(s) 17, 362
TspGWI ACGGA 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 39
VspI ATTAAT 1 cut(s) 372
XagI CCTNNNNNAGG 1 cut(s) 16
XapI RAATTY 2 cut(s) 269, 671
XbaI TCTAGA 1 cut(s) 326
XceI RCATGY 1 cut(s) 572
XcmI CCANNNNNNNNNTGG 1 cut(s) 490
XmiI GTMKAC 1 cut(s) 615
XspI CTAG 4 cut(s) 131, 327, 533, 651
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.