RchiOBHm_Chr2g0122571

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
35602258 .. 35602777
520 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49496

Sequence Viewer

Length: 204 bp
ATGACGCCATCTAACTCCACGATCCCAACCCCTCTGGGCTTCGCCGGTTTTGTTCGTCAGATGTCCGGGAAGCTCTCCACACCGGAATCGGGTCTGGGCTTCCCTTGCAGGTCTCGGATGACGTCAAAACGAAGACATTATTTGGGGGCAGTAATGTGTCTACTGCCCCCCACTAAACCATTAAAACTTGCACCAGTTAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.25

Weight (kDa)

11.05

Isoelectric Point (pI)

66.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 125
Acc36I ACCTGC 1 cut(s) 99
AccI GTMKAC 1 cut(s) 160
AclWI GGATC 1 cut(s) 16
AcyI GRCGYC 2 cut(s) 5, 122
AfiI CCNNNNNNNGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 16
AsuC2I CCSGG 1 cut(s) 67
BbsI GAAGAC 1 cut(s) 139
BccI CCATC 1 cut(s) 16
BcnI CCSGG 1 cut(s) 67
BcoDI GTCTC 1 cut(s) 117
BfuAI ACCTGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 67
BmrFI CCNGG 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 139
BpuMI CCSGG 1 cut(s) 67
BsaHI GRCGYC 2 cut(s) 5, 122
BsaI GGTCTC 1 cut(s) 117
BsaWI WCCGGW 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 89
Bse118I RCCGGY 1 cut(s) 44
Bse1I ACTGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 194
BsiSI CCGG 3 cut(s) 45, 66, 83
BslI CCNNNNNNNGG 1 cut(s) 89
BsmAI GTCTC 1 cut(s) 117
Bso31I GGTCTC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 21
BspMI ACCTGC 1 cut(s) 99
BspPI GGATC 1 cut(s) 16
BspTNI GGTCTC 1 cut(s) 117
BsrFI RCCGGY 1 cut(s) 44
BsrI ACTGG 1 cut(s) 194
BssAI RCCGGY 1 cut(s) 44
BssMI GATC 1 cut(s) 21
BssNI GRCGYC 2 cut(s) 5, 122
BstACI GRCGYC 2 cut(s) 5, 122
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 65
BstV2I GAAGAC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 123
BveI ACCTGC 1 cut(s) 99
Cfr10I RCCGGY 1 cut(s) 44
CseI GACGC 1 cut(s) 13
CviJI RGCY 3 cut(s) 39, 73, 99
CviKI_1 RGCY 3 cut(s) 39, 73, 99
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
Eco31I GGTCTC 1 cut(s) 117
FblI GTMKAC 1 cut(s) 160
FokI GGATG 1 cut(s) 130
HapII CCGG 3 cut(s) 45, 66, 83
HgaI GACGC 1 cut(s) 13
Hin1I GRCGYC 2 cut(s) 5, 122
HinfI GANTC 1 cut(s) 86
HpaII CCGG 3 cut(s) 45, 66, 83
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 60, 117
Hpy8I GTNNAC 1 cut(s) 161
HpyCH4IV ACGT 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 108, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 122
Hsp92I GRCGYC 2 cut(s) 5, 122
Kzo9I GATC 1 cut(s) 21
LpnPI CCDG 6 cut(s) 20, 58, 79, 80, 94, 96
MaeII ACGT 1 cut(s) 122
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 144
MnlI CCTC 1 cut(s) 42
MseI TTAA 2 cut(s) 182, 198
MspI CCGG 3 cut(s) 45, 66, 83
MspR9I CCNGG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 105
NciI CCSGG 1 cut(s) 67
NdeII GATC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 86
PfoI TCCNGGA 1 cut(s) 65
SaqAI TTAA 2 cut(s) 182, 198
Sau3AI GATC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 67
SetI ASST 3 cut(s) 75, 113, 125
StyD4I CCNGG 1 cut(s) 65
TaiI ACGT 1 cut(s) 125
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 182, 198
Tru9I TTAA 2 cut(s) 182, 198
XmiI GTMKAC 1 cut(s) 160
ZraI GACGTC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.