Rroxscaffold_3G00266470

FMN-dependent dehydrogenase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
59730968 .. 59731541
574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00266470.1

Sequence Viewer

Length: 168 bp
ATGCCACCAAGTTTGACATTGAAAAACTTTGAAAATTTGGATCTTGGAAAGATTGATGAGACCAATGATTCTGGATTAGCATTGTATGTTGCTGGACTGTTTGCCCGCTATCTCAGCTGGAAGGATGTGAAATGGCTTCAGCCAATCACTACATTACCAATTCGTTAA

Protein Analysis

55

Amino Acids

6.26

Weight (kDa)

6.03

Isoelectric Point (pI)

31.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AclWI GGATC 1 cut(s) 48
AcsI RAATTY 1 cut(s) 34
AcuI CTGAAG 1 cut(s) 122
AgsI TTSAA 2 cut(s) 22, 32
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
Alw26I GTCTC 1 cut(s) 53
AlwI GGATC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 53
BsaI GGTCTC 1 cut(s) 53
BseGI GGATG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 53
Bso31I GGTCTC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 40
BspACI CCGC 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 126
BspPI GGATC 1 cut(s) 48
BspTNI GGTCTC 1 cut(s) 53
BssMI GATC 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BtsCI GGATG 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 106
CspCI CAANNNNNGTGG 1 cut(s) 29
CviJI RGCY 3 cut(s) 117, 136, 142
CviKI_1 RGCY 3 cut(s) 117, 136, 142
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco31I GGTCTC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 122
FaiI YATR 1 cut(s) 87
FauI CCCGC 1 cut(s) 113
FokI GGATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 68
Hpy188III TCNNGA 1 cut(s) 72
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
HpyF3I CTNAG 1 cut(s) 113
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 57, 78, 103
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MflI RGATCY 1 cut(s) 40
MluCI AATT 2 cut(s) 34, 159
MseI TTAA 1 cut(s) 166
MspA1I CMGCKG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 114
NdeII GATC 1 cut(s) 40
PfeI GAWTC 1 cut(s) 68
PsuI RGATCY 1 cut(s) 40
PvuII CAGCTG 1 cut(s) 117
SaqAI TTAA 1 cut(s) 166
Sau3AI GATC 1 cut(s) 40
SetI ASST 1 cut(s) 119
SgeI CNNG 6 cut(s) 21, 56, 84, 105, 117, 130
Sse9I AATT 2 cut(s) 34, 159
SsiI CCGC 1 cut(s) 106
TaaI ACNGT 1 cut(s) 99
TasI AATT 2 cut(s) 34, 159
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 166
Tru9I TTAA 1 cut(s) 166
XapI RAATTY 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.