Rmu_sc0007181.1_g000001

peroxisomal (S)-2-hydroxy-acid oxidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007181.1
OG0000887
Physical Location & Seq
Forward (+)
1 .. 428
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007181.1_g000001.1.cds

Sequence Viewer

Length: 235 bp
tattgttcaggtgttcaaagacaggaatctggttacatggcttgtcagaagggctgagagggctggttacaaggcaatagttctcactgctgacactccaaggctcgggcgcagggacgctgatatcaagaacaggtttactatgccaccatgtttgacattgaaaaactttgaaaatttggatcttggaaagattcttggaaagattgatgaggttggacccatttacttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00630 ko01100 ko01110 ko01120 ko01130 ko01200 ko04146 map00630 map01100 map01110 map01120 map01130 map01200 map04146
Pfam Domains
Protein Families
FMN_dh

Protein Analysis

77

Amino Acids

8.86

Weight (kDa)

9.8

Isoelectric Point (pI)

15.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 190
AcsI RAATTY 1 cut(s) 176
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 3 cut(s) 17, 164, 174
AlwI GGATC 1 cut(s) 190
Ama87I CYCGRG 1 cut(s) 105
ApoI RAATTY 1 cut(s) 176
AspLEI GCGC 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 219
AvaI CYCGRG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 219
Bme18I GGWCC 1 cut(s) 219
BmeT110I CYCGRG 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 219
BmiI GGNNCC 1 cut(s) 221
BsaJI CCNNGG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 46
BsiHKCI CYCGRG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 105
BsmFI GGGAC 1 cut(s) 129
BsoBI CYCGRG 1 cut(s) 105
Bsp143I GATC 1 cut(s) 182
BspCNI CTCAG 1 cut(s) 47
BspLI GGNNCC 1 cut(s) 221
BspPI GGATC 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 182
BssT1I CCWWGG 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 55
BstHHI GCGC 1 cut(s) 112
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 182
BstYI RGATCY 1 cut(s) 182
BtsI GCAGTG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 85
CfoI GCGC 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 219
CseI GACGC 1 cut(s) 126
CspCI CAANNNNNGTGG 2 cut(s) 136, 171
CviAII CATG 2 cut(s) 37, 151
CviJI RGCY 4 cut(s) 41, 54, 63, 104
CviKI_1 RGCY 4 cut(s) 41, 54, 63, 104
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
Eco130I CCWWGG 1 cut(s) 99
Eco32I GATATC 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 219
Eco88I CYCGRG 1 cut(s) 105
EcoRV GATATC 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 2 cut(s) 40, 154
FaiI YATR 3 cut(s) 38, 144, 152
FaqI GGGAC 1 cut(s) 129
FatI CATG 2 cut(s) 36, 150
GlaI GCGC 1 cut(s) 111
HgaI GACGC 1 cut(s) 126
HhaI GCGC 1 cut(s) 112
Hin1II CATG 2 cut(s) 40, 154
Hin6I GCGC 1 cut(s) 110
HinP1I GCGC 1 cut(s) 110
HinfI GANTC 2 cut(s) 26, 194
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 48, 234
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
HpyF3I CTNAG 1 cut(s) 55
Hsp92II CATG 2 cut(s) 40, 154
HspAI GCGC 1 cut(s) 110
Kzo9I GATC 1 cut(s) 182
LpnPI CCDG 5 cut(s) 8, 15, 49, 98, 119
MaeIII GTNAC 2 cut(s) 32, 66
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MflI RGATCY 1 cut(s) 182
MluCI AATT 1 cut(s) 176
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 2 cut(s) 52, 206
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 1 cut(s) 182
NlaIII CATG 2 cut(s) 40, 154
NlaIV GGNNCC 1 cut(s) 221
PfeI GAWTC 2 cut(s) 26, 194
PspN4I GGNNCC 1 cut(s) 221
PspPI GGNCC 1 cut(s) 219
PsuI RGATCY 1 cut(s) 182
Sau3AI GATC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 219
SetI ASST 3 cut(s) 13, 138, 217
SinI GGWCC 1 cut(s) 219
Sse9I AATT 1 cut(s) 176
StyI CCWWGG 1 cut(s) 99
TasI AATT 1 cut(s) 176
TfiI GAWTC 2 cut(s) 26, 194
TscAI CASTG 1 cut(s) 92
TspRI CASTG 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 219
XapI RAATTY 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.