RchiOBHm_Chr4g0403981

Glutamate-gated receptor that probably acts as non- selective cation channel

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
23496567 .. 23496972
406 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37561

Sequence Viewer

Length: 270 bp
ATGGACGAGAACTGCATGACACTTGATGATTTTTATGCTAAGCATGCTCATTATCAAACAAGGCTTTTCTTTCTCACCAGGGATTCAAAGAATGATGTTGTTTCAGCAACATTTGAAGTGAGTGCCATTATCAGACCTCAAAGTTCAGCAGAAGCAAAGTTTGTGATAGAGCTGGGAAGAAGGAATCATGTTCCGATTATTTCATTTTCTGCCACTAGTCCATATTTTTCTCCATCTAATAGCTCATATTTCATTGAGACAGCTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.16

Weight (kDa)

5.82

Isoelectric Point (pI)

71.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ANF_receptor PF01094 8 - 87 2.2e-10 Receptor family ligand binding region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 87, 116
AhlI ACTAGT 1 cut(s) 215
AjnI CCWGG 1 cut(s) 77
AluBI AGCT 3 cut(s) 172, 243, 263
AluI AGCT 3 cut(s) 172, 243, 263
Alw26I GTCTC 1 cut(s) 251
AsuHPI GGTGA 1 cut(s) 67
BccI CCATC 1 cut(s) 241
BciT130I CCWGG 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 251
BcuI ACTAGT 1 cut(s) 215
BfaI CTAG 1 cut(s) 216
BlpI GCTNAGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 79
Bpu1102I GCTNAGC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 78
BseYI CCCAGC 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 251
Bsp1720I GCTNAGC 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 39
BstMAI GTCTC 1 cut(s) 251
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 45
CviAII CATG 3 cut(s) 16, 44, 188
CviJI RGCY 4 cut(s) 64, 172, 243, 263
CviKI_1 RGCY 4 cut(s) 64, 172, 243, 263
DdeI CTNAG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 77
FaeI CATG 3 cut(s) 19, 47, 191
FaiI YATR 6 cut(s) 17, 36, 45, 189, 223, 247
FatI CATG 3 cut(s) 15, 43, 187
FspBI CTAG 1 cut(s) 216
GsaI CCCAGC 1 cut(s) 176
Hin1II CATG 3 cut(s) 19, 47, 191
HinfI GANTC 2 cut(s) 83, 184
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 134, 195
HpyAV CCTTC 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 15
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 3 cut(s) 19, 47, 191
LpnPI CCDG 3 cut(s) 64, 91, 158
MaeI CTAG 1 cut(s) 216
MboII GAAGA 1 cut(s) 189
MnlI CCTC 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 79
MwoI GCNNNNNNNGC 1 cut(s) 44
NlaIII CATG 3 cut(s) 19, 47, 191
NspI RCATGY 1 cut(s) 47
PaeI GCATGC 1 cut(s) 47
PfeI GAWTC 2 cut(s) 83, 184
Psp6I CCWGG 1 cut(s) 77
PspFI CCCAGC 1 cut(s) 172
PspGI CCWGG 1 cut(s) 77
ScrFI CCNGG 1 cut(s) 79
SetI ASST 4 cut(s) 139, 174, 245, 265
SpeI ACTAGT 1 cut(s) 215
SphI GCATGC 1 cut(s) 47
SspMI CTAG 1 cut(s) 216
StyD4I CCNGG 1 cut(s) 77
TfiI GAWTC 2 cut(s) 83, 184
TspDTI ATGAA 2 cut(s) 192, 241
XceI RCATGY 1 cut(s) 47
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.