Rh2BG397100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0000721
Physical Location & Seq
Reverse (-)
56300749 .. 56301087
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG397100.1

Sequence Viewer

Length: 339 bp
ATGAACATGGTCCTCACCATACTCACCCTCGAATGCAAATCAAGCCCAATAATCCCATTCTCATCCTCATCAGACTCGGATCCAAACCCAACGAGCCTCACACAGCTCTCAAATGGCTCCACCCTACCTACAGAAGACGTCGCCTCACCGGATTCTGACCCGGAAACCCTCCTTCCCATGAAGAAGTCATCTTCATCAGGATCATCAAAACAATTCCTAAAATCTAACCCTAACCCTAAACTCAAATCCAGATGCAACCCATCATCCATGTCGCAATTCCCCTCCACAACCCCAAAATCGGAGTCGCCGAAGACCAAAACGGAACGGGCCGTTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

11.94

Weight (kDa)

8.64

Isoelectric Point (pI)

67.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 141
AclWI GGATC 3 cut(s) 74, 87, 208
AcyI GRCGYC 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 298
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
AlwI GGATC 3 cut(s) 74, 87, 208
AoxI GGCC 1 cut(s) 327
ArsI GACNNNNNNTTYG 2 cut(s) 287, 319
AspS9I GGNCC 2 cut(s) 10, 327
AsuC2I CCSGG 1 cut(s) 161
AsuHPI GGTGA 3 cut(s) 7, 16, 138
AvaII GGWCC 1 cut(s) 10
BamHI GGATCC 1 cut(s) 79
BbsI GAAGAC 2 cut(s) 141, 317
BccI CCATC 1 cut(s) 268
BceAI ACGGC 1 cut(s) 314
BcnI CCSGG 1 cut(s) 161
BfmI CTRYAG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 10
BmgT120I GGNCC 2 cut(s) 10, 327
BmiI GGNNCC 2 cut(s) 81, 118
BmrFI CCNGG 1 cut(s) 161
BmsI GCATC 1 cut(s) 242
BpiI GAAGAC 2 cut(s) 141, 317
BpuMI CCSGG 1 cut(s) 161
BsaHI GRCGYC 1 cut(s) 138
BsaWI WCCGGW 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 298
BseGI GGATG 2 cut(s) 62, 263
BseLI CCNNNNNNNGG 1 cut(s) 298
BshFI GGCC 1 cut(s) 329
BsiSI CCGG 2 cut(s) 149, 161
BslI CCNNNNNNNGG 1 cut(s) 298
BsmI GAATGC 1 cut(s) 38
BsnI GGCC 1 cut(s) 329
Bsp143I GATC 2 cut(s) 79, 200
BspANI GGCC 1 cut(s) 329
BspLI GGNNCC 2 cut(s) 81, 118
BspPI GGATC 3 cut(s) 74, 87, 208
BssMI GATC 2 cut(s) 79, 200
BssNI GRCGYC 1 cut(s) 138
BstACI GRCGYC 1 cut(s) 138
BstF5I GGATG 2 cut(s) 62, 263
BstKTI GATC 2 cut(s) 82, 203
BstMBI GATC 2 cut(s) 79, 200
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 129
BstV2I GAAGAC 2 cut(s) 141, 317
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuRI GGCC 1 cut(s) 329
BtsCI GGATG 2 cut(s) 62, 263
Cfr13I GGNCC 2 cut(s) 10, 327
CviAII CATG 3 cut(s) 7, 178, 268
CviJI RGCY 5 cut(s) 45, 96, 106, 117, 329
CviKI_1 RGCY 5 cut(s) 45, 96, 106, 117, 329
DpnI GATC 2 cut(s) 81, 202
DpnII GATC 2 cut(s) 79, 200
Eco47I GGWCC 1 cut(s) 10
FaeI CATG 3 cut(s) 10, 181, 271
FaiI YATR 4 cut(s) 8, 20, 179, 269
FatI CATG 3 cut(s) 6, 177, 267
FokI GGATG 2 cut(s) 49, 250
HaeIII GGCC 1 cut(s) 329
HapII CCGG 2 cut(s) 149, 161
Hin1I GRCGYC 1 cut(s) 138
Hin1II CATG 3 cut(s) 10, 181, 271
HinfI GANTC 3 cut(s) 74, 152, 302
HpaII CCGG 2 cut(s) 149, 161
HphI GGTGA 3 cut(s) 7, 16, 138
Hpy188I TCNGA 4 cut(s) 73, 79, 157, 301
Hpy188III TCNNGA 2 cut(s) 198, 249
Hpy99I CGWCG 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 36, 255
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 138
Hsp92I GRCGYC 1 cut(s) 138
Hsp92II CATG 3 cut(s) 10, 181, 271
Kzo9I GATC 2 cut(s) 79, 200
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 4 cut(s) 162, 174, 183, 262
LweI GCATC 1 cut(s) 242
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 331
MalI GATC 2 cut(s) 81, 202
MboI GATC 2 cut(s) 79, 200
MboII GAAGA 4 cut(s) 146, 183, 193, 322
MflI RGATCY 1 cut(s) 79
MluCI AATT 2 cut(s) 212, 275
MlyI GAGTC 2 cut(s) 68, 311
MnlI CCTC 7 cut(s) 23, 38, 76, 107, 154, 179, 292
MspI CCGG 2 cut(s) 149, 161
MspR9I CCNGG 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 42
NciI CCSGG 1 cut(s) 161
NdeII GATC 2 cut(s) 79, 200
NlaIII CATG 3 cut(s) 10, 181, 271
NlaIV GGNNCC 2 cut(s) 81, 118
PcsI WCGNNNNNNNCGW 1 cut(s) 305
PctI GAATGC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 152
PleI GAGTC 2 cut(s) 68, 310
PpsI GAGTC 2 cut(s) 68, 310
PspN4I GGNNCC 2 cut(s) 81, 118
PspPI GGNCC 2 cut(s) 10, 327
PsuI RGATCY 1 cut(s) 79
Sau3AI GATC 2 cut(s) 79, 200
Sau96I GGNCC 2 cut(s) 10, 327
SchI GAGTC 2 cut(s) 68, 311
ScrFI CCNGG 1 cut(s) 161
SetI ASST 4 cut(s) 108, 130, 141, 338
SfaNI GCATC 1 cut(s) 242
SfcI CTRYAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 10
Sse9I AATT 2 cut(s) 212, 275
StyD4I CCNGG 1 cut(s) 159
TaiI ACGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 30
TasI AATT 2 cut(s) 212, 275
TfiI GAWTC 1 cut(s) 152
TspDTI ATGAA 3 cut(s) 17, 183, 194
TspGWI ACGGA 1 cut(s) 335
VpaK11BI GGWCC 1 cut(s) 10
ZraI GACGTC 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.