Rmu_sc0012229.1_g000015

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012229.1
Physical Location & Seq
Forward (+)
56118 .. 58384
2267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012229.1_g000015.1.cds

Sequence Viewer

Length: 348 bp
atggggacggagacggggaatccccagtatctcattacggggattggggagggtatggggatgaagaatgaagtcgggtctgtggatggtaatttaatccccttaccctaccctccccattgccatccctacctatttcaatccaattcagttccagtgaagctagttggcgatttgaaccatttgatttctgctaccatgtctggtgtgacttgctgtttgaggttccctgggcaactcaactctgacctcagaaagttggctgtcaatctcattccattcccccgtctccactttttcattccattcctggtgggatgttttaatgcagaaaaagtttgttcttag
Functional Annotation

Protein Analysis

115

Amino Acids

12.5

Weight (kDa)

6.88

Isoelectric Point (pI)

27.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 140, 178
AjnI CCWGG 2 cut(s) 229, 309
AluBI AGCT 1 cut(s) 163
AluI AGCT 1 cut(s) 163
Alw26I GTCTC 2 cut(s) 5, 293
ArsI GACNNNNNNTTYG 2 cut(s) 202, 234
BccI CCATC 2 cut(s) 80, 132
BciT130I CCWGG 2 cut(s) 231, 311
BcoDI GTCTC 2 cut(s) 5, 293
BfaI CTAG 1 cut(s) 164
Bme1390I CCNGG 2 cut(s) 231, 311
BmiI GGNNCC 1 cut(s) 227
BmrFI CCNGG 2 cut(s) 231, 311
BmrI ACTGGG 1 cut(s) 19
BmuI ACTGGG 1 cut(s) 19
BsaJI CCNNGG 2 cut(s) 229, 230
Bse1I ACTGG 2 cut(s) 25, 155
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 2 cut(s) 231, 311
BseDI CCNNGG 2 cut(s) 229, 230
BseGI GGATG 4 cut(s) 66, 91, 124, 323
BseMI GCAATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 265
BseNI ACTGG 2 cut(s) 25, 155
BslFI GGGAC 1 cut(s) 19
BsmAI GTCTC 2 cut(s) 5, 293
BsmBI CGTCTC 2 cut(s) 5, 293
BsmFI GGGAC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 264
BspLI GGNNCC 1 cut(s) 227
BsrDI GCAATG 1 cut(s) 118
BsrI ACTGG 2 cut(s) 25, 155
BssECI CCNNGG 2 cut(s) 229, 230
Bst2UI CCWGG 2 cut(s) 231, 311
BstDEI CTNAG 2 cut(s) 251, 345
BstF5I GGATG 4 cut(s) 66, 91, 124, 323
BstMAI GTCTC 2 cut(s) 5, 293
BstNI CCWGG 2 cut(s) 231, 311
BstSCI CCNGG 2 cut(s) 229, 309
BtsCI GGATG 4 cut(s) 66, 91, 124, 323
BtsIMutI CAGTG 1 cut(s) 162
CviAII CATG 1 cut(s) 199
CviJI RGCY 2 cut(s) 163, 263
CviKI_1 RGCY 2 cut(s) 163, 263
DdeI CTNAG 2 cut(s) 251, 345
EcoRII CCWGG 2 cut(s) 229, 309
Esp3I CGTCTC 2 cut(s) 5, 293
FaeI CATG 1 cut(s) 202
FaiI YATR 2 cut(s) 56, 200
FaqI GGGAC 1 cut(s) 19
FatI CATG 1 cut(s) 198
FokI GGATG 4 cut(s) 73, 98, 111, 330
FspBI CTAG 1 cut(s) 164
Hin1II CATG 1 cut(s) 202
HinfI GANTC 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 247, 254
HpyCH4V TGCA 1 cut(s) 329
HpyF3I CTNAG 2 cut(s) 251, 345
Hsp92II CATG 1 cut(s) 202
LpnPI CCDG 7 cut(s) 38, 168, 189, 216, 243, 296, 323
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 208
MboII GAAGA 1 cut(s) 76
MluCI AATT 2 cut(s) 91, 145
MnlI CCTC 4 cut(s) 43, 123, 216, 260
MseI TTAA 2 cut(s) 95, 324
MspR9I CCNGG 2 cut(s) 231, 311
MvaI CCWGG 2 cut(s) 231, 311
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 1 cut(s) 227
NmuCI GTSAC 1 cut(s) 208
PasI CCCWGGG 1 cut(s) 230
PfeI GAWTC 1 cut(s) 19
Psp6I CCWGG 2 cut(s) 229, 309
PspGI CCWGG 2 cut(s) 229, 309
PspN4I GGNNCC 1 cut(s) 227
SaqAI TTAA 2 cut(s) 95, 324
ScrFI CCNGG 2 cut(s) 231, 311
SetI ASST 4 cut(s) 135, 165, 227, 252
Sse9I AATT 2 cut(s) 91, 145
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 2 cut(s) 229, 309
TasI AATT 2 cut(s) 91, 145
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 2 cut(s) 95, 324
Tru9I TTAA 2 cut(s) 95, 324
TscAI CASTG 1 cut(s) 162
TseFI GTSAC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 3 cut(s) 77, 84, 289
TspGWI ACGGA 1 cut(s) 23
TspRI CASTG 1 cut(s) 162
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.