RchiOBHm_Chr6g0278531

Zeaxanthin epoxidase, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000348
Physical Location & Seq
Reverse (-)
41613718 .. 41615118
1401 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24985

Sequence Viewer

Length: 597 bp
ATGTTGTTTTACTTGTCGAAATGCCAATTTGAGTCGTTCAGACTTTTGAATAGAGGAGTGTTGCTTACTCAACCATTTCTGGGCTTCCAGTTTTTGGAATGTCATTTAAGGCCAAAGGAAAAAAAGGAGACCATGAAGTTCGTTGTGTGCAAAGGAAGCTGTTGTTGGAATCCCTTGCAAATAAATGAACTTCCTAGTGGCACAACCAGGTTCTCATCAAAATTTGTTTCAATCGAAGAATCAGGCTACTTTAAGCTTCTGCATCTTGCTGATGGAACCATCCTCAAAGACAAAGGGAAATCCGCTATTAGAGGTCAGGCAAACTTCAAGAGCAATCATGGATTTGATCCCATATCCATGCGGTTCTTCAGGCATGGAGTTAGATCTGGTGTCATCCCTTGTGATCAAAAAAGCTGTTTATCGGGGAGCGAAGGAAAGTTGATGACCTTGTTGAACAGATTTCTGGGGCCTTTAATCCCCAAGTTGCTGTTGAAAAAGGCTGATTTTGATTGTGGGAAGCTCAGCACCACTTGCATTACTTTCTATTGGTATCTTAGATATGCAATGATTCATGCTTTAAAATTCTGGAATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3

Protein Analysis

198

Amino Acids

22.72

Weight (kDa)

9.6

Isoelectric Point (pI)

32.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000348)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G38540 AT5G05320
fragaria_vesca FvH4_1g12561 FvH4_1g12581 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_3g33121 FvH4_3g33122 FvH4_4g08974 FvH4_4g09610 FvH4_7g17841
malus_domestica MD05G1123600.v1.1 MD05G1123700.v1.1
prunus_persica Prupe.8G167400_v2.0.a1 Prupe.8G167500_v2.0.a1 Prupe.8G167700_v2.0.a1 Prupe.8G167700_v2.0.a1
pyrus_communis pycom05g11780 pycom05g11790
rosa_chinensis RchiOBHm_Chr6g0278521 RchiOBHm_Chr6g0278531 RchiOBHm_Chr6g0278551 RchiOBHm_Chr6g0278591 RchiOBHm_Chr6g0278611 RchiOBHm_Chr6g0278671 RchiOBHm_Chr6g0278691 RchiOBHm_Chr6g0278701
rosa_laevigata RLG00000013200 RLG00000013201 RLG00000013203 RLG00000013205 RLG00000013206 RLG00000013210 RLG00000013211 RLG00000013213 RLG00000013216 RLG00000013217
rosa_multiflora Rmu_sc0000258.1_g000072 Rmu_sc0000258.1_g000073 Rmu_sc0000258.1_g000082 Rmu_sc0000258.1_g000083 Rmu_sc0000258.1_g000090 Rmu_sc0000258.1_g000094 Rmu_sc0000258.1_g000096 Rmu_sc0002777.1_g000006 Rmu_sc0002777.1_g000011 Rmu_sc0002777.1_g000019 Rmu_sc0006193.1_g000001 Rmu_sc0034228.1_g000001 Rmu_ssc0000042.1_g000052 Rmu_ssc0000144.1_g000014
rosa_roxburghii Rroxscaffold_7G00189700 Rroxscaffold_7G00189710 Rroxscaffold_7G00189720 Rroxscaffold_7G00189730 Rroxscaffold_7G00189770 Rroxscaffold_7G00189800 Rroxscaffold_7G00189820 Rroxscaffold_7G00189960 Rroxscaffold_7G00190070 Rroxscaffold_7G00190090 Rroxscaffold_7G00190140 Rroxscaffold_7G00190160 Rroxscaffold_7G00190170 Rroxscaffold_7G00190270 Rroxscaffold_7G00190280 Rroxscaffold_7G00190300 Rroxscaffold_7G00190310
rosa_rugosa Rorug02G0222700 Rorug06G0117300 Rorug06G0117400 Rorug06G0117700 Rorug06G0117900 Rorug06G0118000 Rorug06G0118100 Rorug06G0118200
rosa_samantha Rh1BG066900 Rh2BG292300 Rh6BG231700 Rh6BG231800 Rh6BG232000 Rh6BG232300 Rh6BG232500 Rh6CG234100 Rh6CG234200 Rh6CG234300 Rh6CG234700 Rh6DG225400 Rh6DG225500 Rh6DG225800 Rh6DG226000 Rh6DG226300
rosa_wichuraiana Rw0G003090 Rw0G003690 Rw0G021770 Rw4G037090 Rw6G019870 Rw6G019890 Rw6G019900 Rw6G019910 Rw6G019920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 94
AciI CCGC 2 cut(s) 303, 361
AclWI GGATC 1 cut(s) 341
AcsI RAATTY 3 cut(s) 221, 581, 589
AcuI CTGAAG 1 cut(s) 352
AfiI CCNNNNNNNGG 2 cut(s) 80, 94
AgsI TTSAA 5 cut(s) 49, 231, 328, 454, 493
AjnI CCWGG 1 cut(s) 206
AjuI GAANNNNNNNTTGG 2 cut(s) 148, 180
AluBI AGCT 4 cut(s) 159, 256, 414, 520
AluI AGCT 4 cut(s) 159, 256, 414, 520
Alw26I GTCTC 1 cut(s) 122
AlwI GGATC 1 cut(s) 341
AoxI GGCC 2 cut(s) 110, 467
ApoI RAATTY 3 cut(s) 221, 581, 589
AspS9I GGNCC 1 cut(s) 467
BccI CCATC 2 cut(s) 266, 287
BciT130I CCWGG 1 cut(s) 208
BclI TGATCA 1 cut(s) 403
BcoDI GTCTC 1 cut(s) 122
BfaI CTAG 1 cut(s) 195
BglII AGATCT 1 cut(s) 383
BlpI GCTNAGC 1 cut(s) 521
Bme1390I CCNGG 1 cut(s) 208
BmgT120I GGNCC 1 cut(s) 467
BmiI GGNNCC 2 cut(s) 277, 468
BmrFI CCNGG 1 cut(s) 208
BmsI GCATC 1 cut(s) 271
Bpu1102I GCTNAGC 1 cut(s) 521
BsaI GGTCTC 1 cut(s) 122
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 94
Bse1I ACTGG 1 cut(s) 88
Bse3DI GCAATG 1 cut(s) 570
BseBI CCWGG 1 cut(s) 208
BseGI GGATG 2 cut(s) 279, 393
BseLI CCNNNNNNNGG 2 cut(s) 80, 94
BseMI GCAATG 1 cut(s) 570
BseMII CTCAG 1 cut(s) 535
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 69
BshFI GGCC 2 cut(s) 112, 469
BslI CCNNNNNNNGG 2 cut(s) 80, 94
BsmAI GTCTC 1 cut(s) 122
BsnI GGCC 2 cut(s) 112, 469
Bso31I GGTCTC 1 cut(s) 122
Bsp143I GATC 3 cut(s) 346, 383, 403
Bsp1720I GCTNAGC 1 cut(s) 521
BspACI CCGC 2 cut(s) 303, 361
BspANI GGCC 2 cut(s) 112, 469
BspCNI CTCAG 1 cut(s) 534
BspLI GGNNCC 2 cut(s) 277, 468
BspPI GGATC 1 cut(s) 341
BspTNI GGTCTC 1 cut(s) 122
BsrDI GCAATG 1 cut(s) 570
BsrI ACTGG 1 cut(s) 88
BssMI GATC 3 cut(s) 346, 383, 403
Bst2UI CCWGG 1 cut(s) 208
BstAPI GCANNNNNTGC 1 cut(s) 531
BstDEI CTNAG 2 cut(s) 521, 554
BstF5I GGATG 2 cut(s) 279, 393
BstKTI GATC 3 cut(s) 349, 386, 406
BstMAI GTCTC 1 cut(s) 122
BstMBI GATC 3 cut(s) 346, 383, 403
BstMWI GCNNNNNNNGC 2 cut(s) 156, 531
BstNI CCWGG 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 206
BstX2I RGATCY 1 cut(s) 383
BstYI RGATCY 1 cut(s) 383
BsuRI GGCC 2 cut(s) 112, 469
BtsCI GGATG 2 cut(s) 279, 393
Cfr13I GGNCC 1 cut(s) 467
CsiI ACCWGGT 1 cut(s) 206
CviAII CATG 5 cut(s) 133, 338, 358, 374, 572
CviJI RGCY 9 cut(s) 84, 112, 159, 246, 256, 414, 469, 500, 520
CviKI_1 RGCY 9 cut(s) 84, 112, 159, 246, 256, 414, 469, 500, 520
DdeI CTNAG 2 cut(s) 521, 554
DpnI GATC 3 cut(s) 348, 385, 405
DpnII GATC 3 cut(s) 346, 383, 403
DraI TTTAAA 1 cut(s) 579
Eco31I GGTCTC 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 352
EcoO109I RGGNCCY 1 cut(s) 467
EcoRI GAATTC 1 cut(s) 589
EcoRII CCWGG 1 cut(s) 206
FaeI CATG 5 cut(s) 136, 341, 361, 377, 575
FaiI YATR 7 cut(s) 134, 339, 353, 359, 375, 561, 573
FatI CATG 5 cut(s) 132, 337, 357, 373, 571
FbaI TGATCA 1 cut(s) 403
FokI GGATG 2 cut(s) 266, 380
FspBI CTAG 1 cut(s) 195
HaeIII GGCC 2 cut(s) 112, 469
Hin1II CATG 5 cut(s) 136, 341, 361, 377, 575
HindIII AAGCTT 1 cut(s) 254
HinfI GANTC 4 cut(s) 32, 169, 239, 568
Hpy188I TCNGA 1 cut(s) 41
Hpy188III TCNNGA 3 cut(s) 328, 586, 594
HpyAV CCTTC 1 cut(s) 425
HpyCH4V TGCA 5 cut(s) 150, 178, 262, 534, 563
HpyF10VI GCNNNNNNNGC 2 cut(s) 156, 531
HpyF3I CTNAG 2 cut(s) 521, 554
Hsp92II CATG 5 cut(s) 136, 341, 361, 377, 575
Ksp22I TGATCA 1 cut(s) 403
Kzo9I GATC 3 cut(s) 346, 383, 403
LmnI GCTCC 1 cut(s) 426
LweI GCATC 1 cut(s) 271
MabI ACCWGGT 1 cut(s) 206
MaeI CTAG 1 cut(s) 195
MalI GATC 3 cut(s) 348, 385, 405
MboI GATC 3 cut(s) 346, 383, 403
MboII GAAGA 2 cut(s) 248, 358
MflI RGATCY 1 cut(s) 383
MluCI AATT 4 cut(s) 26, 221, 581, 589
MlyI GAGTC 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 146
MnlI CCTC 3 cut(s) 47, 293, 305
MseI TTAA 4 cut(s) 107, 252, 473, 578
MslI CAYNNNNRTG 1 cut(s) 356
MspR9I CCNGG 1 cut(s) 208
MvaI CCWGG 1 cut(s) 208
MwoI GCNNNNNNNGC 2 cut(s) 156, 531
NdeII GATC 3 cut(s) 346, 383, 403
NlaIII CATG 5 cut(s) 136, 341, 361, 377, 575
NlaIV GGNNCC 2 cut(s) 277, 468
PfeI GAWTC 3 cut(s) 169, 239, 568
PflMI CCANNNNNTGG 1 cut(s) 94
PleI GAGTC 1 cut(s) 40
PpsI GAGTC 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 206
PspGI CCWGG 1 cut(s) 206
PspN4I GGNNCC 2 cut(s) 277, 468
PspPI GGNCC 1 cut(s) 467
PsuI RGATCY 1 cut(s) 383
RseI CAYNNNNRTG 1 cut(s) 356
SaqAI TTAA 4 cut(s) 107, 252, 473, 578
Sau3AI GATC 3 cut(s) 346, 383, 403
Sau96I GGNCC 1 cut(s) 467
SchI GAGTC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 208
SetI ASST 7 cut(s) 161, 212, 258, 316, 416, 449, 522
SexAI ACCWGGT 1 cut(s) 206
SfaNI GCATC 1 cut(s) 271
SmiMI CAYNNNNRTG 1 cut(s) 356
Sse9I AATT 4 cut(s) 26, 221, 581, 589
SsiI CCGC 2 cut(s) 303, 361
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 206
TaqI TCGA 2 cut(s) 17, 234
TasI AATT 4 cut(s) 26, 221, 581, 589
TfiI GAWTC 3 cut(s) 169, 239, 568
Tru1I TTAA 4 cut(s) 107, 252, 473, 578
Tru9I TTAA 4 cut(s) 107, 252, 473, 578
TspDTI ATGAA 3 cut(s) 149, 201, 560
Van91I CCANNNNNTGG 1 cut(s) 94
XapI RAATTY 3 cut(s) 221, 581, 589
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.