Rmu_sc0000258.1_g000072

Zeaxanthin epoxidase, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000258.1
OG0000348
Physical Location & Seq
Reverse (-)
319454 .. 321920
2467 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000258.1_g000072.1.cds

Sequence Viewer

Length: 1239 bp
atggaagtagtagaagaaattgtgattgttggagctggaattgctggcctcacaacttccttaggacttcacaggctgggaattcggagcttagtgttggaaacatctgagagtttgaggacgactggatttgcattctcaacatggacaaatgcctggaaggccttggatgccattggaattggggaatctcttcggagacaacacgagacacttcataggaatgttacttactcaacagtttctgggcttccagtgtttgagatgtcactgaaggacaagggaaaacaaggagaccatgaagttcgttgcgtgcagaggaagttgttgttggaagcccttgcaaatgaacttccaagtggcacaatcaggttctcctccaaggtggtttccattgaggaatcaggctactttaagctgctgcatcttgctgatggaaccatcctcaaggccaaggtcttggttgggtgtgatggagtgaactctgtggtggcgaaatggctgggcttcaagccaccggcctttacagggagacatggtataagaggtagtgcgaactacaagaacagtcatgggtttgatcccaacttcatgcagttctttggcaatggtgttagatctggtgccatcccttgtgatgataaaacagtttattggttcttcacttggactccaaccaaccaagagaaagagctagagaggaacccagctgagatgaagcaatttatgttgagcaagctgggaaatatacctgatgaaataaaagctgtaattaaaaacactgaattggatgcttttgtttcctctcctttgagatttaggcatccatgggagcttttttggggaaatattagcaaaggcaatgtttgtgtagctggagatgcgctccatcctatgaccccggaccttggccaaggaggctgctccgcaatagaagacggtgttgtgttggcaagatgtcttggtgaggccttgctgaaaaactcaaggcaagaaatgaaaggtaaaagtgaacaaggaaaggaggaatataagaaaattgagatggggttgaataagtttgccaatgagaggagatggagaggcattgacctgattagtagaggttatatgattgctttaatgcaagggagtgaaggtaaaatgatgtctaccttgaacaaatatttggttccaattctagctaggtggctgctacagaaggccgattttgattgtggaaatctcagcagcatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3

Protein Analysis

412

Amino Acids

45.71

Weight (kDa)

8.82

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000348)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G38540 AT5G05320
fragaria_vesca FvH4_1g12561 FvH4_1g12581 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_3g33121 FvH4_3g33122 FvH4_4g08974 FvH4_4g09610 FvH4_7g17841
malus_domestica MD05G1123600.v1.1 MD05G1123700.v1.1
prunus_persica Prupe.8G167400_v2.0.a1 Prupe.8G167500_v2.0.a1 Prupe.8G167700_v2.0.a1 Prupe.8G167700_v2.0.a1
pyrus_communis pycom05g11780 pycom05g11790
rosa_chinensis RchiOBHm_Chr6g0278521 RchiOBHm_Chr6g0278531 RchiOBHm_Chr6g0278551 RchiOBHm_Chr6g0278591 RchiOBHm_Chr6g0278611 RchiOBHm_Chr6g0278671 RchiOBHm_Chr6g0278691 RchiOBHm_Chr6g0278701
rosa_laevigata RLG00000013200 RLG00000013201 RLG00000013203 RLG00000013205 RLG00000013206 RLG00000013210 RLG00000013211 RLG00000013213 RLG00000013216 RLG00000013217
rosa_multiflora Rmu_sc0000258.1_g000072 Rmu_sc0000258.1_g000073 Rmu_sc0000258.1_g000082 Rmu_sc0000258.1_g000083 Rmu_sc0000258.1_g000090 Rmu_sc0000258.1_g000094 Rmu_sc0000258.1_g000096 Rmu_sc0002777.1_g000006 Rmu_sc0002777.1_g000011 Rmu_sc0002777.1_g000019 Rmu_sc0006193.1_g000001 Rmu_sc0034228.1_g000001 Rmu_ssc0000042.1_g000052 Rmu_ssc0000144.1_g000014
rosa_roxburghii Rroxscaffold_7G00189700 Rroxscaffold_7G00189710 Rroxscaffold_7G00189720 Rroxscaffold_7G00189730 Rroxscaffold_7G00189770 Rroxscaffold_7G00189800 Rroxscaffold_7G00189820 Rroxscaffold_7G00189960 Rroxscaffold_7G00190070 Rroxscaffold_7G00190090 Rroxscaffold_7G00190140 Rroxscaffold_7G00190160 Rroxscaffold_7G00190170 Rroxscaffold_7G00190270 Rroxscaffold_7G00190280 Rroxscaffold_7G00190300 Rroxscaffold_7G00190310
rosa_rugosa Rorug02G0222700 Rorug06G0117300 Rorug06G0117400 Rorug06G0117700 Rorug06G0117900 Rorug06G0118000 Rorug06G0118100 Rorug06G0118200
rosa_samantha Rh1BG066900 Rh2BG292300 Rh6BG231700 Rh6BG231800 Rh6BG232000 Rh6BG232300 Rh6BG232500 Rh6CG234100 Rh6CG234200 Rh6CG234300 Rh6CG234700 Rh6DG225400 Rh6DG225500 Rh6DG225800 Rh6DG226000 Rh6DG226300
rosa_wichuraiana Rw0G003090 Rw0G003690 Rw0G021770 Rw4G037090 Rw6G019870 Rw6G019890 Rw6G019900 Rw6G019910 Rw6G019920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 623
AccI GTMKAC 1 cut(s) 1151
AciI CCGC 1 cut(s) 927
AclWI GGATC 1 cut(s) 575
AcoI YGGCCR 1 cut(s) 910
AcsI RAATTY 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 293
AfiI CCNNNNNNNGG 3 cut(s) 528, 908, 1071
AgsI TTSAA 3 cut(s) 511, 1054, 1159
AjnI CCWGG 1 cut(s) 155
AjuI GAANNNNNNNTTGG 4 cut(s) 314, 346, 1151, 1183
Alw26I GTCTC 4 cut(s) 193, 203, 288, 526
AlwI GGATC 1 cut(s) 575
AlwNI CAGNNNCTG 2 cut(s) 245, 1236
AoxI GGCC 7 cut(s) 46, 162, 450, 519, 910, 969, 1203
ApeKI GCWGC 5 cut(s) 418, 421, 921, 1192, 1230
ApoI RAATTY 1 cut(s) 81
Asp700I GAANNNNTTC 1 cut(s) 192
AspLEI GCGC 1 cut(s) 886
AspS9I GGNCC 1 cut(s) 904
AsuC2I CCSGG 1 cut(s) 902
AsuHPI GGTGA 1 cut(s) 977
AvaII GGWCC 1 cut(s) 904
AxyI CCTNAGG 1 cut(s) 61
BalI TGGCCA 1 cut(s) 912
BanI GGYRCC 1 cut(s) 623
BauI CACGAG 1 cut(s) 206
BbsI GAAGAC 1 cut(s) 942
BbvI GCAGC 4 cut(s) 405, 408, 908, 1179
BccI CCATC 7 cut(s) 428, 449, 467, 635, 897, 1039, 1071
BciT130I CCWGG 1 cut(s) 157
BcnI CCSGG 1 cut(s) 902
BcoDI GTCTC 4 cut(s) 193, 203, 288, 526
BfaI CTAG 3 cut(s) 695, 1181, 1185
BfmI CTRYAG 1 cut(s) 1196
BglI GCCNNNNNGGC 2 cut(s) 161, 918
BglII AGATCT 1 cut(s) 617
BisI GCNGC 5 cut(s) 419, 422, 922, 1193, 1231
BlsI GCNGC 5 cut(s) 420, 423, 923, 1194, 1232
Bme1390I CCNGG 2 cut(s) 157, 902
Bme18I GGWCC 1 cut(s) 904
BmgT120I GGNCC 1 cut(s) 904
BmiI GGNNCC 4 cut(s) 439, 625, 704, 1173
BmrFI CCNGG 2 cut(s) 157, 902
BmsI GCATC 5 cut(s) 160, 433, 781, 832, 871
BpiI GAAGAC 1 cut(s) 942
BplI GAGNNNNNCTC 2 cut(s) 870, 902
BpmI CTGGAG 1 cut(s) 897
BpuEI CTTGAG 2 cut(s) 431, 970
BpuMI CCSGG 1 cut(s) 902
BsaI GGTCTC 1 cut(s) 288
BsaJI CCNNGG 7 cut(s) 165, 381, 453, 827, 900, 907, 913
BsaXI ACNNNNNCTCC 6 cut(s) 523, 553, 655, 685, 1123, 1153
Bsc4I CCNNNNNNNGG 3 cut(s) 528, 908, 1071
Bse118I RCCGGY 1 cut(s) 517
Bse1I ACTGG 2 cut(s) 130, 254
Bse21I CCTNAGG 1 cut(s) 61
Bse3DI GCAATG 2 cut(s) 613, 868
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 7 cut(s) 165, 381, 453, 827, 900, 907, 913
BseGI GGATG 6 cut(s) 175, 441, 627, 796, 823, 889
BseLI CCNNNNNNNGG 3 cut(s) 528, 908, 1071
BseMI GCAATG 2 cut(s) 613, 868
BseMII CTCAG 2 cut(s) 99, 702
BseNI ACTGG 2 cut(s) 130, 254
BseRI GAGGAG 2 cut(s) 367, 1087
BseXI GCAGC 4 cut(s) 405, 408, 908, 1179
BseYI CCCAGC 4 cut(s) 76, 502, 706, 739
BsgI GTGCAG 1 cut(s) 335
BshFI GGCC 7 cut(s) 48, 164, 452, 521, 912, 971, 1205
BshNI GGYRCC 1 cut(s) 623
BsiSI CCGG 2 cut(s) 518, 902
BslI CCNNNNNNNGG 3 cut(s) 528, 908, 1071
BsmAI GTCTC 4 cut(s) 193, 203, 288, 526
BsmI GAATGC 1 cut(s) 134
BsnI GGCC 7 cut(s) 48, 164, 452, 521, 912, 971, 1205
Bso31I GGTCTC 1 cut(s) 288
Bsp143I GATC 2 cut(s) 580, 617
Bsp19I CCATGG 1 cut(s) 827
BspACI CCGC 1 cut(s) 927
BspANI GGCC 7 cut(s) 48, 164, 452, 521, 912, 971, 1205
BspCNI CTCAG 3 cut(s) 100, 703, 1239
BspLI GGNNCC 4 cut(s) 439, 625, 704, 1173
BspPI GGATC 1 cut(s) 575
BspT107I GGYRCC 1 cut(s) 623
BspTNI GGTCTC 1 cut(s) 288
BsrDI GCAATG 2 cut(s) 613, 868
BsrFI RCCGGY 1 cut(s) 517
BsrI ACTGG 2 cut(s) 130, 254
BssAI RCCGGY 1 cut(s) 517
BssECI CCNNGG 7 cut(s) 165, 381, 453, 827, 900, 907, 913
BssMI GATC 2 cut(s) 580, 617
BssSI CACGAG 1 cut(s) 206
BssT1I CCWWGG 6 cut(s) 165, 381, 453, 827, 907, 913
Bst2BI CACGAG 1 cut(s) 206
Bst2UI CCWGG 1 cut(s) 157
Bst4CI ACNGT 4 cut(s) 241, 569, 649, 941
Bst6I CTCTTC 1 cut(s) 198
BstC8I GCNNGC 3 cut(s) 46, 314, 737
BstDEI CTNAG 5 cut(s) 61, 91, 108, 711, 1226
BstDSI CCRYGG 1 cut(s) 827
BstF5I GGATG 6 cut(s) 175, 441, 627, 796, 823, 889
BstHHI GCGC 1 cut(s) 886
BstKTI GATC 2 cut(s) 583, 620
BstMAI GTCTC 4 cut(s) 193, 203, 288, 526
BstMBI GATC 2 cut(s) 580, 617
BstMWI GCNNNNNNNGC 5 cut(s) 41, 161, 170, 881, 918
BstNI CCWGG 1 cut(s) 157
BstSCI CCNGG 2 cut(s) 155, 900
BstSFI CTRYAG 1 cut(s) 1196
BstV1I GCAGC 4 cut(s) 405, 408, 908, 1179
BstV2I GAAGAC 1 cut(s) 942
BstX2I RGATCY 1 cut(s) 617
BstXI CCANNNNNNTGG 1 cut(s) 460
BstYI RGATCY 1 cut(s) 617
Bsu36I CCTNAGG 1 cut(s) 61
BsuRI GGCC 7 cut(s) 48, 164, 452, 521, 912, 971, 1205
BtgI CCRYGG 1 cut(s) 827
BtsCI GGATG 6 cut(s) 175, 441, 627, 796, 823, 889
BtsIMutI CAGTG 3 cut(s) 261, 269, 780
Cac8I GCNNGC 3 cut(s) 46, 314, 737
CaiI CAGNNNCTG 2 cut(s) 245, 1236
CfoI GCGC 1 cut(s) 886
Cfr10I RCCGGY 1 cut(s) 517
Cfr13I GGNCC 1 cut(s) 904
CviAII CATG 6 cut(s) 144, 299, 536, 572, 592, 828
DdeI CTNAG 5 cut(s) 61, 91, 108, 711, 1226
DpnI GATC 2 cut(s) 582, 619
DpnII GATC 2 cut(s) 580, 617
EaeI YGGCCR 1 cut(s) 910
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
Eco130I CCWWGG 6 cut(s) 165, 381, 453, 827, 907, 913
Eco147I AGGCCT 2 cut(s) 164, 971
Eco31I GGTCTC 1 cut(s) 288
Eco47I GGWCC 1 cut(s) 904
Eco57I CTGAAG 1 cut(s) 293
Eco81I CCTNAGG 1 cut(s) 61
EcoRI GAATTC 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 155
EcoT14I CCWWGG 6 cut(s) 165, 381, 453, 827, 907, 913
ErhI CCWWGG 6 cut(s) 165, 381, 453, 827, 907, 913
FaeI CATG 6 cut(s) 147, 302, 539, 575, 595, 831
FatI CATG 6 cut(s) 143, 298, 535, 571, 591, 827
FblI GTMKAC 1 cut(s) 1151
Fnu4HI GCNGC 5 cut(s) 419, 422, 922, 1193, 1231
FokI GGATG 6 cut(s) 182, 428, 614, 803, 810, 876
Fsp4HI GCNGC 5 cut(s) 419, 422, 922, 1193, 1231
FspBI CTAG 3 cut(s) 695, 1181, 1185
GlaI GCGC 1 cut(s) 885
GluI GCNGC 5 cut(s) 419, 422, 922, 1193, 1231
GsaI CCCAGC 4 cut(s) 80, 506, 710, 743
GsuI CTGGAG 1 cut(s) 897
HaeIII GGCC 7 cut(s) 48, 164, 452, 521, 912, 971, 1205
HapII CCGG 2 cut(s) 518, 902
HhaI GCGC 1 cut(s) 886
Hin1II CATG 6 cut(s) 147, 302, 539, 575, 595, 831
Hin6I GCGC 1 cut(s) 884
HinP1I GCGC 1 cut(s) 884
HinfI GANTC 3 cut(s) 188, 401, 670
HpaII CCGG 2 cut(s) 518, 902
HphI GGTGA 1 cut(s) 977
Hpy166II GTNNAC 3 cut(s) 481, 1013, 1152
Hpy188I TCNGA 4 cut(s) 87, 109, 198, 1238
Hpy8I GTNNAC 3 cut(s) 481, 1013, 1152
HpyAV CCTTC 4 cut(s) 154, 268, 1130, 1195
HpyCH4III ACNGT 4 cut(s) 241, 569, 649, 941
HpyCH4V TGCA 6 cut(s) 134, 316, 344, 424, 595, 1126
HpyF10VI GCNNNNNNNGC 5 cut(s) 41, 161, 170, 881, 918
HpyF3I CTNAG 5 cut(s) 61, 91, 108, 711, 1226
Hsp92II CATG 6 cut(s) 147, 302, 539, 575, 595, 831
HspAI GCGC 1 cut(s) 884
Kzo9I GATC 2 cut(s) 580, 617
LmnI GCTCC 5 cut(s) 32, 87, 832, 891, 929
Lsp1109I GCAGC 4 cut(s) 405, 408, 908, 1179
LweI GCATC 5 cut(s) 160, 433, 781, 832, 871
MaeI CTAG 3 cut(s) 695, 1181, 1185
MaeIII GTNAC 2 cut(s) 226, 267
MalI GATC 2 cut(s) 582, 619
MboI GATC 2 cut(s) 580, 617
MboII GAAGA 4 cut(s) 26, 185, 652, 947
MflI RGATCY 1 cut(s) 617
MlsI TGGCCA 1 cut(s) 912
MluCI AATT 9 cut(s) 18, 39, 81, 180, 722, 771, 785, 1038, 1176
MluNI TGGCCA 1 cut(s) 912
MlyI GAGTC 1 cut(s) 664
MmeI TCCRAC 4 cut(s) 10, 78, 312, 698
Mox20I TGGCCA 1 cut(s) 912
MroXI GAANNNNTTC 1 cut(s) 192
MscI TGGCCA 1 cut(s) 912
MseI TTAA 3 cut(s) 414, 774, 1121
MslI CAYNNNNRTG 1 cut(s) 222
Msp20I TGGCCA 1 cut(s) 912
MspA1I CMGCKG 1 cut(s) 710
MspI CCGG 2 cut(s) 518, 902
MspR9I CCNGG 2 cut(s) 157, 902
Mva1269I GAATGC 1 cut(s) 134
MvaI CCWGG 1 cut(s) 157
MwoI GCNNNNNNNGC 5 cut(s) 41, 161, 170, 881, 918
NciI CCSGG 1 cut(s) 902
NcoI CCATGG 1 cut(s) 827
NdeII GATC 2 cut(s) 580, 617
NlaIII CATG 6 cut(s) 147, 302, 539, 575, 595, 831
NlaIV GGNNCC 4 cut(s) 439, 625, 704, 1173
NmuCI GTSAC 1 cut(s) 267
PceI AGGCCT 2 cut(s) 164, 971
PctI GAATGC 1 cut(s) 134
PdmI GAANNNNTTC 1 cut(s) 192
PfeI GAWTC 2 cut(s) 188, 401
PkrI GCNGC 5 cut(s) 420, 423, 923, 1194, 1232
PleI GAGTC 1 cut(s) 664
PpsI GAGTC 1 cut(s) 664
Psp6I CCWGG 1 cut(s) 155
PspFI CCCAGC 4 cut(s) 76, 502, 706, 739
PspGI CCWGG 1 cut(s) 155
PspN4I GGNNCC 4 cut(s) 439, 625, 704, 1173
PspPI GGNCC 1 cut(s) 904
PstNI CAGNNNCTG 2 cut(s) 245, 1236
PsuI RGATCY 1 cut(s) 617
PvuII CAGCTG 1 cut(s) 710
RseI CAYNNNNRTG 1 cut(s) 222
SaqAI TTAA 3 cut(s) 414, 774, 1121
SatI GCNGC 5 cut(s) 419, 422, 922, 1193, 1231
Sau3AI GATC 2 cut(s) 580, 617
Sau96I GGNCC 1 cut(s) 904
SchI GAGTC 1 cut(s) 664
ScrFI CCNGG 2 cut(s) 157, 902
SfaNI GCATC 5 cut(s) 160, 433, 781, 832, 871
SfcI CTRYAG 1 cut(s) 1196
SinI GGWCC 1 cut(s) 904
SmiMI CAYNNNNRTG 1 cut(s) 222
SmlI CTYRAG 2 cut(s) 446, 985
SmoI CTYRAG 2 cut(s) 446, 985
Sse9I AATT 9 cut(s) 18, 39, 81, 180, 722, 771, 785, 1038, 1176
SseBI AGGCCT 2 cut(s) 164, 971
SsiI CCGC 1 cut(s) 927
SspI AATATT 2 cut(s) 850, 1166
SspMI CTAG 3 cut(s) 695, 1181, 1185
StuI AGGCCT 2 cut(s) 164, 971
StyD4I CCNGG 2 cut(s) 155, 900
StyI CCWWGG 6 cut(s) 165, 381, 453, 827, 907, 913
TaaI ACNGT 4 cut(s) 241, 569, 649, 941
TasI AATT 9 cut(s) 18, 39, 81, 180, 722, 771, 785, 1038, 1176
TfiI GAWTC 2 cut(s) 188, 401
Tru1I TTAA 3 cut(s) 414, 774, 1121
Tru9I TTAA 3 cut(s) 414, 774, 1121
TscAI CASTG 3 cut(s) 261, 276, 787
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 5 cut(s) 418, 421, 921, 1192, 1230
Tsp45I GTSAC 1 cut(s) 267
TspDTI ATGAA 7 cut(s) 206, 315, 363, 580, 731, 771, 1013
TspRI CASTG 3 cut(s) 261, 276, 787
VpaK11BI GGWCC 1 cut(s) 904
XapI RAATTY 1 cut(s) 81
XmiI GTMKAC 1 cut(s) 1151
XmnI GAANNNNTTC 1 cut(s) 192
XspI CTAG 3 cut(s) 695, 1181, 1185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.