Rmu_ssc0000042.1_g000052

FAD binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000042.1
OG0000348
Physical Location & Seq
Forward (+)
314406 .. 314756
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000042.1_g000052.1.cds

Sequence Viewer

Length: 234 bp
atggatatggcaggggatacaagagaagatgttgtgattgtgggtggtgggatttcaggcctcgccactgctcttgctcttcacagaaagggcataagaagcttggtcctagaaaaatcaaagactttacaagccaccggaggtatcgttgtgcattctaatggttggcatgcccttgaacagctcggcgtagccccatatcttagacaaactgctgatcctatactatcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3

Protein Analysis

77

Amino Acids

8.06

Weight (kDa)

6.82

Isoelectric Point (pI)

32.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000348)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G38540 AT5G05320
fragaria_vesca FvH4_1g12561 FvH4_1g12581 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_2g15511 FvH4_3g33121 FvH4_3g33122 FvH4_4g08974 FvH4_4g09610 FvH4_7g17841
malus_domestica MD05G1123600.v1.1 MD05G1123700.v1.1
prunus_persica Prupe.8G167400_v2.0.a1 Prupe.8G167500_v2.0.a1 Prupe.8G167700_v2.0.a1 Prupe.8G167700_v2.0.a1
pyrus_communis pycom05g11780 pycom05g11790
rosa_chinensis RchiOBHm_Chr6g0278521 RchiOBHm_Chr6g0278531 RchiOBHm_Chr6g0278551 RchiOBHm_Chr6g0278591 RchiOBHm_Chr6g0278611 RchiOBHm_Chr6g0278671 RchiOBHm_Chr6g0278691 RchiOBHm_Chr6g0278701
rosa_laevigata RLG00000013200 RLG00000013201 RLG00000013203 RLG00000013205 RLG00000013206 RLG00000013210 RLG00000013211 RLG00000013213 RLG00000013216 RLG00000013217
rosa_multiflora Rmu_sc0000258.1_g000072 Rmu_sc0000258.1_g000073 Rmu_sc0000258.1_g000082 Rmu_sc0000258.1_g000083 Rmu_sc0000258.1_g000090 Rmu_sc0000258.1_g000094 Rmu_sc0000258.1_g000096 Rmu_sc0002777.1_g000006 Rmu_sc0002777.1_g000011 Rmu_sc0002777.1_g000019 Rmu_sc0006193.1_g000001 Rmu_sc0034228.1_g000001 Rmu_ssc0000042.1_g000052 Rmu_ssc0000144.1_g000014
rosa_roxburghii Rroxscaffold_7G00189700 Rroxscaffold_7G00189710 Rroxscaffold_7G00189720 Rroxscaffold_7G00189730 Rroxscaffold_7G00189770 Rroxscaffold_7G00189800 Rroxscaffold_7G00189820 Rroxscaffold_7G00189960 Rroxscaffold_7G00190070 Rroxscaffold_7G00190090 Rroxscaffold_7G00190140 Rroxscaffold_7G00190160 Rroxscaffold_7G00190170 Rroxscaffold_7G00190270 Rroxscaffold_7G00190280 Rroxscaffold_7G00190300 Rroxscaffold_7G00190310
rosa_rugosa Rorug02G0222700 Rorug06G0117300 Rorug06G0117400 Rorug06G0117700 Rorug06G0117900 Rorug06G0118000 Rorug06G0118100 Rorug06G0118200
rosa_samantha Rh1BG066900 Rh2BG292300 Rh6BG231700 Rh6BG231800 Rh6BG232000 Rh6BG232300 Rh6BG232500 Rh6CG234100 Rh6CG234200 Rh6CG234300 Rh6CG234700 Rh6DG225400 Rh6DG225500 Rh6DG225800 Rh6DG226000 Rh6DG226300
rosa_wichuraiana Rw0G003090 Rw0G003690 Rw0G021770 Rw4G037090 Rw6G019870 Rw6G019890 Rw6G019900 Rw6G019910 Rw6G019920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 212
AgsI TTSAA 1 cut(s) 179
AluBI AGCT 2 cut(s) 102, 184
AluI AGCT 2 cut(s) 102, 184
AlwI GGATC 1 cut(s) 212
AoxI GGCC 1 cut(s) 58
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BciVI GTATCC 1 cut(s) 10
BfaI CTAG 1 cut(s) 110
BfuI GTATCC 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BsaWI WCCGGW 1 cut(s) 137
BsaXI ACNNNNNCTCC 2 cut(s) 132, 162
BshFI GGCC 1 cut(s) 60
BsiSI CCGG 1 cut(s) 138
BsmI GAATGC 1 cut(s) 154
BsnI GGCC 1 cut(s) 60
Bsp143I GATC 1 cut(s) 217
BspANI GGCC 1 cut(s) 60
BspPI GGATC 1 cut(s) 212
BspQI GCTCTTC 1 cut(s) 84
BssMI GATC 1 cut(s) 217
Bst6I CTCTTC 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 203
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstMWI GCNNNNNNNGC 1 cut(s) 99
BstNSI RCATGY 1 cut(s) 173
BsuI GTATCC 1 cut(s) 10
BsuRI GGCC 1 cut(s) 60
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 106
CspCI CAANNNNNGTGG 2 cut(s) 55, 90
CviAII CATG 1 cut(s) 170
CviJI RGCY 5 cut(s) 60, 102, 134, 184, 194
CviKI_1 RGCY 5 cut(s) 60, 102, 134, 184, 194
DdeI CTNAG 1 cut(s) 203
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco147I AGGCCT 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 106
FaeI CATG 1 cut(s) 173
FaiI YATR 5 cut(s) 8, 95, 171, 199, 224
FatI CATG 1 cut(s) 169
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 60
HapII CCGG 1 cut(s) 138
Hin1II CATG 1 cut(s) 173
HindIII AAGCTT 1 cut(s) 100
HpaII CCGG 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 217
LguI GCTCTTC 1 cut(s) 84
LpnPI CCDG 2 cut(s) 42, 151
MaeI CTAG 1 cut(s) 110
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 2 cut(s) 38, 71
MnlI CCTC 2 cut(s) 71, 134
MslI CAYNNNNRTG 1 cut(s) 159
MspI CCGG 1 cut(s) 138
Mva1269I GAATGC 1 cut(s) 154
MwoI GCNNNNNNNGC 1 cut(s) 99
NdeII GATC 1 cut(s) 217
NlaIII CATG 1 cut(s) 173
NmeAIII GCCGAG 1 cut(s) 165
NspI RCATGY 1 cut(s) 173
PaeI GCATGC 1 cut(s) 173
PceI AGGCCT 1 cut(s) 60
PciSI GCTCTTC 1 cut(s) 84
PctI GAATGC 1 cut(s) 154
PspPI GGNCC 1 cut(s) 106
RseI CAYNNNNRTG 1 cut(s) 159
SapI GCTCTTC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 217
Sau96I GGNCC 1 cut(s) 106
SetI ASST 3 cut(s) 104, 145, 186
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 159
SphI GCATGC 1 cut(s) 173
SseBI AGGCCT 1 cut(s) 60
SspMI CTAG 1 cut(s) 110
StuI AGGCCT 1 cut(s) 60
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 106
XceI RCATGY 1 cut(s) 173
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.