RchiOBHm_Chr7g0185751

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000693
Physical Location & Seq
Forward (+)
5833434 .. 5833943
510 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16579

Sequence Viewer

Length: 207 bp
ATGCCGGATTGTATGCAGGCACATATTGATCATTCCAATGCCCTTGGTTTGCTTGATATCCTCCAAACATGTTATTTTGATCGAAGTAAGCTTGATATTGCATGTTTGGACATGTCTCCGTTGAATGACCAACCAAGGAGCATATGGAACACATCTCGTATGAAAGATGCCACATTGCAAAATAAAAAGAAAAGAAAGTTAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.88

Weight (kDa)

7.74

Isoelectric Point (pI)

83.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 2 cut(s) 68, 111
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 120
BclI TGATCA 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 120
BmsI GCATC 1 cut(s) 157
BsaJI CCNNGG 2 cut(s) 43, 134
Bse3DI GCAATG 1 cut(s) 173
BseDI CCNNGG 2 cut(s) 43, 134
BseMI GCAATG 1 cut(s) 173
BsiSI CCGG 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 28, 79
BsrDI GCAATG 1 cut(s) 173
BssECI CCNNGG 2 cut(s) 43, 134
BssMI GATC 2 cut(s) 28, 79
BssT1I CCWWGG 2 cut(s) 43, 134
BstC8I GCNNGC 1 cut(s) 18
BstKTI GATC 2 cut(s) 31, 82
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 2 cut(s) 28, 79
BstNSI RCATGY 3 cut(s) 72, 105, 115
Cac8I GCNNGC 1 cut(s) 18
CviAII CATG 3 cut(s) 69, 102, 112
CviJI RGCY 1 cut(s) 91
CviKI_1 RGCY 1 cut(s) 91
DpnI GATC 2 cut(s) 30, 81
DpnII GATC 2 cut(s) 28, 79
Eco130I CCWWGG 2 cut(s) 43, 134
Eco32I GATATC 1 cut(s) 58
EcoRV GATATC 1 cut(s) 58
EcoT14I CCWWGG 2 cut(s) 43, 134
ErhI CCWWGG 2 cut(s) 43, 134
FaeI CATG 3 cut(s) 72, 105, 115
FaiI YATR 8 cut(s) 14, 24, 70, 103, 113, 143, 145, 161
FatI CATG 3 cut(s) 68, 101, 111
FauNDI CATATG 1 cut(s) 143
FbaI TGATCA 1 cut(s) 28
HapII CCGG 1 cut(s) 5
Hin1II CATG 3 cut(s) 72, 105, 115
HindIII AAGCTT 1 cut(s) 89
HpaII CCGG 1 cut(s) 5
HpyCH4V TGCA 3 cut(s) 16, 101, 178
Hsp92II CATG 3 cut(s) 72, 105, 115
Ksp22I TGATCA 1 cut(s) 28
Kzo9I GATC 2 cut(s) 28, 79
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 2 cut(s) 2, 18
LweI GCATC 1 cut(s) 157
MalI GATC 2 cut(s) 30, 81
MboI GATC 2 cut(s) 28, 79
MnlI CCTC 1 cut(s) 71
MslI CAYNNNNRTG 1 cut(s) 36
MspI CCGG 1 cut(s) 5
NdeI CATATG 1 cut(s) 143
NdeII GATC 2 cut(s) 28, 79
NlaIII CATG 3 cut(s) 72, 105, 115
NspI RCATGY 3 cut(s) 72, 105, 115
PciI ACATGT 2 cut(s) 68, 111
PscI ACATGT 2 cut(s) 68, 111
RseI CAYNNNNRTG 1 cut(s) 36
Sau3AI GATC 2 cut(s) 28, 79
SetI ASST 1 cut(s) 93
SfaNI GCATC 1 cut(s) 157
SmiMI CAYNNNNRTG 1 cut(s) 36
StyI CCWWGG 2 cut(s) 43, 134
TaqI TCGA 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 176
TspGWI ACGGA 1 cut(s) 108
XceI RCATGY 3 cut(s) 72, 105, 115
XcmI CCANNNNNNNNNTGG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.