Rh1DG111500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0000693
Physical Location & Seq
Forward (+)
20500342 .. 20502571
2230 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG111500.1

Sequence Viewer

Length: 192 bp
ATGGTAGATTGGGAAGTGAAAATTCAATTCATATTGGGCAGTAGATTGGGAAGCATTTTTACGATATCGGCCTATGTCGGCCACTTTCATCCACTTCCACCTGTGGTCTCCATGGAACTGTTCAAGAGTCTAGACGAATTCATGGACATCCTCAATGAATACGCTATGCATTGGTCACTAGTCTTGTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.36

Weight (kDa)

4.97

Isoelectric Point (pI)

29.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 79
AcsI RAATTY 2 cut(s) 21, 137
AfaI GTAC 1 cut(s) 188
AgsI TTSAA 2 cut(s) 26, 124
AhlI ACTAGT 1 cut(s) 178
Alw26I GTCTC 1 cut(s) 112
AoxI GGCC 2 cut(s) 69, 79
ApoI RAATTY 2 cut(s) 21, 137
BarI GAAGNNNNNNTAC 2 cut(s) 43, 75
BcoDI GTCTC 1 cut(s) 112
BcuI ACTAGT 1 cut(s) 178
BfaI CTAG 2 cut(s) 131, 179
BsaI GGTCTC 1 cut(s) 112
BsaJI CCNNGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 2 cut(s) 88, 147
BshFI GGCC 2 cut(s) 71, 81
BsmAI GTCTC 1 cut(s) 112
BsnI GGCC 2 cut(s) 71, 81
Bso31I GGTCTC 1 cut(s) 112
Bsp19I CCATGG 1 cut(s) 111
BspANI GGCC 2 cut(s) 71, 81
BspTNI GGTCTC 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 120
BstDSI CCRYGG 1 cut(s) 111
BstF5I GGATG 2 cut(s) 88, 147
BstMAI GTCTC 1 cut(s) 112
BsuRI GGCC 2 cut(s) 71, 81
BtgI CCRYGG 1 cut(s) 111
BtsCI GGATG 2 cut(s) 88, 147
Csp6I GTAC 1 cut(s) 187
CviAII CATG 2 cut(s) 112, 142
CviJI RGCY 2 cut(s) 71, 81
CviKI_1 RGCY 2 cut(s) 71, 81
CviQI GTAC 1 cut(s) 187
EaeI YGGCCR 1 cut(s) 79
Eco130I CCWWGG 1 cut(s) 111
Eco31I GGTCTC 1 cut(s) 112
Eco32I GATATC 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 137
EcoRV GATATC 1 cut(s) 66
EcoT14I CCWWGG 1 cut(s) 111
EcoT22I ATGCAT 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 2 cut(s) 115, 145
FaiI YATR 5 cut(s) 32, 75, 113, 143, 167
FatI CATG 2 cut(s) 111, 141
FokI GGATG 2 cut(s) 75, 134
FspBI CTAG 2 cut(s) 131, 179
HaeIII GGCC 2 cut(s) 71, 81
Hin1II CATG 2 cut(s) 115, 145
HinfI GANTC 1 cut(s) 127
Hpy188III TCNNGA 2 cut(s) 124, 131
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 169
Hsp92II CATG 2 cut(s) 115, 145
LpnPI CCDG 1 cut(s) 114
MaeI CTAG 2 cut(s) 131, 179
MaeIII GTNAC 1 cut(s) 174
MluCI AATT 3 cut(s) 21, 26, 137
MlyI GAGTC 1 cut(s) 136
MnlI CCTC 1 cut(s) 161
Mph1103I ATGCAT 1 cut(s) 171
NcoI CCATGG 1 cut(s) 111
NlaIII CATG 2 cut(s) 115, 145
NmuCI GTSAC 1 cut(s) 174
NsiI ATGCAT 1 cut(s) 171
PleI GAGTC 1 cut(s) 135
PpsI GAGTC 1 cut(s) 135
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SchI GAGTC 1 cut(s) 136
SetI ASST 1 cut(s) 103
SgeI CNNG 5 cut(s) 113, 124, 136, 143, 154
SpeI ACTAGT 1 cut(s) 178
Sse9I AATT 3 cut(s) 21, 26, 137
SspMI CTAG 2 cut(s) 131, 179
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 1 cut(s) 120
TasI AATT 3 cut(s) 21, 26, 137
TatI WGTACW 1 cut(s) 186
TseFI GTSAC 1 cut(s) 174
Tsp45I GTSAC 1 cut(s) 174
TspDTI ATGAA 4 cut(s) 19, 77, 130, 171
XapI RAATTY 2 cut(s) 21, 137
XbaI TCTAGA 1 cut(s) 130
XspI CTAG 2 cut(s) 131, 179
Zsp2I ATGCAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.