RchiOBHm_Chr7g0214791

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000693
Physical Location & Seq
Forward (+)
32189456 .. 32189646
191 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19216

Sequence Viewer

Length: 123 bp
ATGTTGGCATTAAAGATGAAGATCTTCTTTTGCTTTAATTATAGCTTGGTTTGCAAGTGCACATGGTCTGCTATTCATTTACATCAGTTGCTTAGAGGTATTCAGAAGCTTTGGAAGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.84

Weight (kDa)

9.57

Isoelectric Point (pI)

25.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 45, 109
AluI AGCT 2 cut(s) 45, 109
Alw21I GWGCWC 1 cut(s) 62
Alw44I GTGCAC 1 cut(s) 58
ApaLI GTGCAC 1 cut(s) 58
Asp700I GAANNNNTTC 1 cut(s) 23
BaeGI GKGCMC 1 cut(s) 62
Bbv12I GWGCWC 1 cut(s) 62
BglII AGATCT 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 20
Bse8I GATNNNNATC 1 cut(s) 20
BseJI GATNNNNATC 1 cut(s) 20
BseSI GKGCMC 1 cut(s) 62
BsiHKAI GWGCWC 1 cut(s) 62
Bsp1286I GDGCHC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 21
BssMI GATC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 92
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstMWI GCNNNNNNNGC 1 cut(s) 51
BstSLI GKGCMC 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 21
BstYI RGATCY 1 cut(s) 21
CviAII CATG 1 cut(s) 63
CviJI RGCY 2 cut(s) 45, 109
CviKI_1 RGCY 2 cut(s) 45, 109
DdeI CTNAG 1 cut(s) 92
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
FaeI CATG 1 cut(s) 66
FaiI YATR 2 cut(s) 42, 64
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FatI CATG 1 cut(s) 62
FspEI CC 5 cut(s) 32, 49, 81, 97, 101
Hin1II CATG 1 cut(s) 66
HindIII AAGCTT 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 105
Hpy8I GTNNAC 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 54, 60
HpyF10VI GCNNNNNNNGC 1 cut(s) 51
HpyF3I CTNAG 1 cut(s) 92
Hsp92II CATG 1 cut(s) 66
Kzo9I GATC 1 cut(s) 21
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 2 cut(s) 16, 31
MflI RGATCY 1 cut(s) 21
MhlI GDGCHC 1 cut(s) 62
MluCI AATT 1 cut(s) 37
MnlI CCTC 1 cut(s) 89
MroXI GAANNNNTTC 1 cut(s) 23
MseI TTAA 2 cut(s) 11, 36
MwoI GCNNNNNNNGC 1 cut(s) 51
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 66
PdmI GAANNNNTTC 1 cut(s) 23
PsuI RGATCY 1 cut(s) 21
SaqAI TTAA 2 cut(s) 11, 36
Sau3AI GATC 1 cut(s) 21
SduI GDGCHC 1 cut(s) 62
SetI ASST 3 cut(s) 47, 100, 111
SgeI CNNG 3 cut(s) 58, 67, 75
Sse9I AATT 1 cut(s) 37
TasI AATT 1 cut(s) 37
Tru1I TTAA 2 cut(s) 11, 36
Tru9I TTAA 2 cut(s) 11, 36
TspDTI ATGAA 2 cut(s) 32, 65
VneI GTGCAC 1 cut(s) 58
XmnI GAANNNNTTC 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.