Rh3BG221800
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
20115616 .. 20116346
731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG221800.1

Sequence Viewer

Length: 159 bp
ATGGAATTAAAGCAGTATCCCACTTTAAGAGTGGAAGTTCGGAATGCAAGATTTGAATCACTGGATAGGATGAAAGAAGAGAGCAAGGAAGCAACTATGCAGCTAGTTGATATGGAGTGTGGTTACCTCACCGTTGAATTTTTCCGCAAGCTTCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.29

Weight (kDa)

5.34

Isoelectric Point (pI)

36.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 145
AcsI RAATTY 1 cut(s) 137
AgsI TTSAA 2 cut(s) 56, 137
AluBI AGCT 2 cut(s) 103, 151
AluI AGCT 2 cut(s) 103, 151
ApeKI GCWGC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 137
AsuHPI GGTGA 1 cut(s) 121
BbvI GCAGC 1 cut(s) 112
BciVI GTATCC 1 cut(s) 27
BfaI CTAG 1 cut(s) 104
BfuI GTATCC 1 cut(s) 27
BisI GCNGC 1 cut(s) 101
BlsI GCNGC 1 cut(s) 102
BsaBI GATNNNNATC 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 66
Bse8I GATNNNNATC 1 cut(s) 55
BseGI GGATG 1 cut(s) 75
BseJI GATNNNNATC 1 cut(s) 55
BseNI ACTGG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 112
BsmI GAATGC 1 cut(s) 49
BspACI CCGC 1 cut(s) 145
BsrI ACTGG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 133
Bst6I CTCTTC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 156
BstEII GGTNACC 1 cut(s) 122
BstF5I GGATG 1 cut(s) 75
BstPI GGTNACC 1 cut(s) 122
BstV1I GCAGC 1 cut(s) 112
BsuI GTATCC 1 cut(s) 27
BtsCI GGATG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 59
Cac8I GCNNGC 1 cut(s) 149
CviJI RGCY 2 cut(s) 103, 151
CviKI_1 RGCY 2 cut(s) 103, 151
DdeI CTNAG 1 cut(s) 156
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Eco91I GGTNACC 1 cut(s) 122
EcoO65I GGTNACC 1 cut(s) 122
FaiI YATR 2 cut(s) 98, 113
Fnu4HI GCNGC 1 cut(s) 101
FokI GGATG 1 cut(s) 82
Fsp4HI GCNGC 1 cut(s) 101
FspBI CTAG 1 cut(s) 104
GluI GCNGC 1 cut(s) 101
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 1 cut(s) 56
HphI GGTGA 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 47, 100
HpyF3I CTNAG 1 cut(s) 156
LpnPI CCDG 1 cut(s) 47
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 122
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 5, 137
MnlI CCTC 1 cut(s) 137
MseI TTAA 2 cut(s) 8, 26
Mva1269I GAATGC 1 cut(s) 49
PctI GAATGC 1 cut(s) 49
PfeI GAWTC 1 cut(s) 56
PkrI GCNGC 1 cut(s) 102
PspEI GGTNACC 1 cut(s) 122
SaqAI TTAA 2 cut(s) 8, 26
SatI GCNGC 1 cut(s) 101
SetI ASST 3 cut(s) 105, 129, 153
SgeI CNNG 4 cut(s) 60, 74, 97, 116
Sse9I AATT 2 cut(s) 5, 137
SsiI CCGC 1 cut(s) 145
SspMI CTAG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 133
TasI AATT 2 cut(s) 5, 137
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 8, 26
Tru9I TTAA 2 cut(s) 8, 26
TscAI CASTG 1 cut(s) 66
TseI GCWGC 1 cut(s) 100
TspDTI ATGAA 1 cut(s) 86
TspRI CASTG 1 cut(s) 66
XapI RAATTY 1 cut(s) 137
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.