Rh7CG391000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000693
Physical Location & Seq
Forward (+)
49565211 .. 49591830
26620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG391000.1

Sequence Viewer

Length: 243 bp
ATGCCATCGGCCTCCAGGACCCGTATCGGTGCCGAGGAACGCACCCACGATGCACCTACCCACCAACCCAGAAGCCAGAACAATGGATTCGTCTTCTTCTTCTTCCAAAACCATCTCAAGGCCATGGAAGATGATGAGCGGTCTGACGGAGGAGCCTTTCCTGGTCGTGATCCTCTGCTTACGGAACTCTTGACCCTTAGAAAACCTCCGATCACTGGTTCTGTTCATTCAGGTATTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.9

Weight (kDa)

6.03

Isoelectric Point (pI)

46.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 29
AccBSI CCGCTC 1 cut(s) 139
AciI CCGC 1 cut(s) 139
AclWI GGATC 1 cut(s) 164
AfiI CCNNNNNNNGG 2 cut(s) 118, 215
AjnI CCWGG 2 cut(s) 14, 160
AlwI GGATC 1 cut(s) 164
AoxI GGCC 2 cut(s) 9, 120
AspS9I GGNCC 1 cut(s) 18
AvaII GGWCC 1 cut(s) 18
BanI GGYRCC 1 cut(s) 29
BbsI GAAGAC 1 cut(s) 85
BccI CCATC 2 cut(s) 13, 120
BciT130I CCWGG 2 cut(s) 16, 162
Bme1390I CCNGG 2 cut(s) 16, 162
Bme18I GGWCC 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 18
BmiI GGNNCC 3 cut(s) 20, 31, 154
BmrFI CCNGG 2 cut(s) 16, 162
BmsI GCATC 1 cut(s) 40
BpiI GAAGAC 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 33, 123
Bsc4I CCNNNNNNNGG 2 cut(s) 118, 215
Bse1I ACTGG 1 cut(s) 220
BseBI CCWGG 2 cut(s) 16, 162
BseDI CCNNGG 2 cut(s) 33, 123
BseLI CCNNNNNNNGG 2 cut(s) 118, 215
BseNI ACTGG 1 cut(s) 220
BseRI GAGGAG 1 cut(s) 165
BshFI GGCC 2 cut(s) 11, 122
BshNI GGYRCC 1 cut(s) 29
BslI CCNNNNNNNGG 2 cut(s) 118, 215
BsnI GGCC 2 cut(s) 11, 122
Bsp143I GATC 2 cut(s) 169, 210
Bsp19I CCATGG 1 cut(s) 123
BspACI CCGC 1 cut(s) 139
BspANI GGCC 2 cut(s) 11, 122
BspLI GGNNCC 3 cut(s) 20, 31, 154
BspPI GGATC 1 cut(s) 164
BspT107I GGYRCC 1 cut(s) 29
BsrBI CCGCTC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 220
BssECI CCNNGG 2 cut(s) 33, 123
BssMI GATC 2 cut(s) 169, 210
BssT1I CCWWGG 1 cut(s) 123
Bst2UI CCWGG 2 cut(s) 16, 162
BstDEI CTNAG 1 cut(s) 197
BstDSI CCRYGG 1 cut(s) 123
BstKTI GATC 2 cut(s) 172, 213
BstMBI GATC 2 cut(s) 169, 210
BstNI CCWGG 2 cut(s) 16, 162
BstSCI CCNGG 2 cut(s) 14, 160
BstV2I GAAGAC 1 cut(s) 85
BstXI CCANNNNNNTGG 1 cut(s) 83
BsuRI GGCC 2 cut(s) 11, 122
BtgI CCRYGG 1 cut(s) 123
BtsIMutI CAGTG 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 18
CviAII CATG 1 cut(s) 124
CviJI RGCY 4 cut(s) 11, 75, 122, 155
CviKI_1 RGCY 4 cut(s) 11, 75, 122, 155
DdeI CTNAG 1 cut(s) 197
DpnI GATC 2 cut(s) 171, 212
DpnII GATC 2 cut(s) 169, 210
Eco130I CCWWGG 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 18
EcoO109I RGGNCCY 1 cut(s) 18
EcoRII CCWGG 2 cut(s) 14, 160
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaeI CATG 1 cut(s) 127
FaiI YATR 1 cut(s) 125
FatI CATG 1 cut(s) 123
HaeIII GGCC 2 cut(s) 11, 122
Hin1II CATG 1 cut(s) 127
HinfI GANTC 1 cut(s) 87
Hpy188I TCNGA 2 cut(s) 145, 210
Hpy188III TCNNGA 2 cut(s) 167, 190
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 1 cut(s) 127
Kzo9I GATC 2 cut(s) 169, 210
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 7 cut(s) 28, 82, 89, 147, 174, 201, 216
LweI GCATC 1 cut(s) 40
MalI GATC 2 cut(s) 171, 212
MbiI CCGCTC 1 cut(s) 139
MboI GATC 2 cut(s) 169, 210
MboII GAAGA 5 cut(s) 85, 88, 91, 94, 140
MnlI CCTC 5 cut(s) 22, 28, 143, 183, 216
MspR9I CCNGG 2 cut(s) 16, 162
MvaI CCWGG 2 cut(s) 16, 162
NcoI CCATGG 1 cut(s) 123
NdeII GATC 2 cut(s) 169, 210
NlaIII CATG 1 cut(s) 127
NlaIV GGNNCC 3 cut(s) 20, 31, 154
NmeAIII GCCGAG 1 cut(s) 58
PfeI GAWTC 1 cut(s) 87
PfoI TCCNGGA 1 cut(s) 14
PpuMI RGGWCCY 1 cut(s) 18
Psp5II RGGWCCY 1 cut(s) 18
Psp6I CCWGG 2 cut(s) 14, 160
PspGI CCWGG 2 cut(s) 14, 160
PspN4I GGNNCC 3 cut(s) 20, 31, 154
PspPI GGNCC 1 cut(s) 18
PspPPI RGGWCCY 1 cut(s) 18
Sau3AI GATC 2 cut(s) 169, 210
Sau96I GGNCC 1 cut(s) 18
ScrFI CCNGG 2 cut(s) 16, 162
SetI ASST 3 cut(s) 58, 208, 235
SfaNI GCATC 1 cut(s) 40
SinI GGWCC 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
SsiI CCGC 1 cut(s) 139
StyD4I CCNGG 2 cut(s) 14, 160
StyI CCWWGG 1 cut(s) 123
TfiI GAWTC 1 cut(s) 87
TscAI CASTG 1 cut(s) 220
TspDTI ATGAA 1 cut(s) 215
TspGWI ACGGA 2 cut(s) 162, 197
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.