Rh4BG253100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0000693
Physical Location & Seq
Reverse (-)
42405214 .. 42408010
2797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG253100.1

Sequence Viewer

Length: 180 bp
ATGAAGGCTCCAGAGCTGATAGCAGCAAGGTATGGAACACTTCTCCAGCTGAGCAAAACTGCCTCAAAGCTCAAGTCTTTCACAACTCAAGTCCTCCATTTTCAAAAAGCAAGCTTCTTTACTGCAACATTTGCAGATTGTGAAGAAGAGAAACCACAAAACCCAAAGAGACCCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.67

Weight (kDa)

9.73

Isoelectric Point (pI)

32.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 104
AluBI AGCT 4 cut(s) 16, 49, 70, 114
AluI AGCT 4 cut(s) 16, 49, 70, 114
Alw26I GTCTC 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 23
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
BbvI GCAGC 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 163
BisI GCNGC 1 cut(s) 24
BlpI GCTNAGC 1 cut(s) 50
BlsI GCNGC 1 cut(s) 25
BmiI GGNNCC 1 cut(s) 9
BpmI CTGGAG 1 cut(s) 29
Bpu1102I GCTNAGC 1 cut(s) 50
BpuEI CTTGAG 2 cut(s) 56, 72
BsaI GGTCTC 1 cut(s) 163
BseMII CTCAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 35
BsmAI GTCTC 1 cut(s) 163
Bso31I GGTCTC 1 cut(s) 163
Bsp1720I GCTNAGC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 9
BspTNI GGTCTC 1 cut(s) 163
Bst6I CTCTTC 1 cut(s) 141
BstAPI GCANNNNNTGC 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 50
BstMAI GTCTC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 35
Cac8I GCNNGC 1 cut(s) 112
CviJI RGCY 5 cut(s) 8, 16, 49, 70, 114
CviKI_1 RGCY 5 cut(s) 8, 16, 49, 70, 114
DdeI CTNAG 1 cut(s) 50
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco31I GGTCTC 1 cut(s) 163
FaiI YATR 1 cut(s) 33
Fnu4HI GCNGC 1 cut(s) 24
Fsp4HI GCNGC 1 cut(s) 24
FspEI CC 9 cut(s) 13, 18, 24, 59, 76, 107, 110, 168, 176
GluI GCNGC 1 cut(s) 24
GsuI CTGGAG 1 cut(s) 29
HindIII AAGCTT 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 125, 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 50
LmnI GCTCC 1 cut(s) 13
LpnPI CCDG 2 cut(s) 24, 59
Lsp1109I GCAGC 1 cut(s) 35
MboII GAAGA 2 cut(s) 155, 158
MnlI CCTC 2 cut(s) 73, 104
MspA1I CMGCKG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 131
NlaIV GGNNCC 1 cut(s) 9
PkrI GCNGC 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 9
PvuII CAGCTG 1 cut(s) 49
SatI GCNGC 1 cut(s) 24
SetI ASST 5 cut(s) 18, 32, 51, 72, 116
SgeI CNNG 6 cut(s) 23, 39, 58, 85, 101, 123
SmlI CTYRAG 2 cut(s) 71, 87
SmoI CTYRAG 2 cut(s) 71, 87
TseI GCWGC 1 cut(s) 23
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.