Rh6BG226400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0000693
Physical Location & Seq
Reverse (-)
42681957 .. 42684818
2862 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG226400.1

Sequence Viewer

Length: 204 bp
ATGACAATTGCGGCGTCGGAGAACAGCGACGGTGTTGTGAACGAGAAAGAAGAAAACCCGATCTTCTCCTTCAACTACGACGACGGCGTTGTGAACGAGAAAGAAGAAGACCCGATTCAGGAACTCACTCTCATAAACATTACAGAGACCAAATCAAAGCAAGAACTCTGTTCCGGAAACAAGGGCTTCTCTGTTGGTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.37

Weight (kDa)

4.1

Isoelectric Point (pI)

46.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 173
AciI CCGC 1 cut(s) 11
AcyI GRCGYC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 118
AgsI TTSAA 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 140
Aor13HI TCCGGA 1 cut(s) 173
BbsI GAAGAC 1 cut(s) 114
BceAI ACGGC 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 140
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BpiI GAAGAC 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 14
BsaI GGTCTC 1 cut(s) 140
BsaWI WCCGGW 1 cut(s) 173
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseAI TCCGGA 1 cut(s) 173
BseLI CCNNNNNNNGG 1 cut(s) 118
BsiSI CCGG 1 cut(s) 174
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 140
Bso31I GGTCTC 1 cut(s) 140
Bsp13I TCCGGA 1 cut(s) 173
Bsp143I GATC 1 cut(s) 60
BspACI CCGC 1 cut(s) 11
BspEI TCCGGA 1 cut(s) 173
BspTNI GGTCTC 1 cut(s) 140
BssMI GATC 1 cut(s) 60
BssNI GRCGYC 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 32
BstACI GRCGYC 1 cut(s) 14
BstKTI GATC 1 cut(s) 63
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 1 cut(s) 60
BstV2I GAAGAC 1 cut(s) 114
CseI GACGC 1 cut(s) 3
CviJI RGCY 1 cut(s) 186
CviKI_1 RGCY 1 cut(s) 186
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 140
FaiI YATR 1 cut(s) 134
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
GluI GCNGC 1 cut(s) 12
HapII CCGG 1 cut(s) 174
HgaI GACGC 1 cut(s) 3
Hin1I GRCGYC 1 cut(s) 14
HinfI GANTC 1 cut(s) 115
HpaII CCGG 1 cut(s) 174
Hpy166II GTNNAC 2 cut(s) 40, 94
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 2 cut(s) 119, 174
Hpy8I GTNNAC 2 cut(s) 40, 94
Hpy99I CGWCG 4 cut(s) 19, 32, 83, 86
HpyAV CCTTC 1 cut(s) 79
HpyCH4III ACNGT 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 14
Kpn2I TCCGGA 1 cut(s) 173
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 104, 187
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 4 cut(s) 55, 62, 116, 119
MfeI CAATTG 1 cut(s) 6
MluCI AATT 1 cut(s) 6
MroI TCCGGA 1 cut(s) 173
MspI CCGG 1 cut(s) 174
MunI CAATTG 1 cut(s) 6
NdeII GATC 1 cut(s) 60
PcsI WCGNNNNNNNCGW 1 cut(s) 84
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 1 cut(s) 13
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 1 cut(s) 60
SgeI CNNG 8 cut(s) 55, 70, 109, 124, 131, 173, 186, 193
Sse9I AATT 1 cut(s) 6
SsiI CCGC 1 cut(s) 11
TaaI ACNGT 1 cut(s) 32
TasI AATT 1 cut(s) 6
TauI GCSGC 1 cut(s) 14
TfiI GAWTC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.