Rmu_co8342433.1_g000001

Endo-1,3(4)-beta-glucanase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8342433.1
Physical Location & Seq
Reverse (-)
1 .. 975
975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8342433.1_g000001.1.cds

Sequence Viewer

Length: 405 bp
atgacttatgaggaagagatttcaaagctagaggcagaagctcaaaagcaaacagggagtggtagactaattgtgttaacagctgagtttctggtgattcttgatatcgagaactacttttgggacgcacttgagtcatggttaaatgtaactcttggtaaaaatggttcttgtgagattaaatggggtgacaattttactaaacaaggatcattggattatggtgcagactttgggtttggactttacattgatcaccataatcacttgggttactttctatatagcatttcagtgcttgctaagattgaacttgaatgggagatgaggtataagcctcaagttgattcacttgctacaaatttcatgaacctggacaagaggacagatttccattattccttg

Protein Analysis

135

Amino Acids

15.66

Weight (kDa)

4.68

Isoelectric Point (pI)

24.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000779)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g29862
rosa_chinensis RchiOBHm_Chr1g0313641 RchiOBHm_Chr4g0408161 RchiOBHm_Chr4g0408171 RchiOBHm_Chr4g0437611 RchiOBHm_Chr4g0437621 RchiOBHm_Chr4g0444671 RchiOBHm_Chr5g0045021 RchiOBHm_Chr5g0070121 RchiOBHm_Chr5g0082551 RchiOBHm_Chr6g0247501 RchiOBHm_Chr6g0271311 RchiOBHm_Chr6g0290811 RchiOBHm_Chr6g0310571
rosa_laevigata RLG00000004718 RLG00000008552 RLG00000015595
rosa_multiflora Rmu_co8342433.1_g000001 Rmu_sc0000147.1_g000080 Rmu_sc0000391.1_g000018 Rmu_sc0000753.1_g000021 Rmu_sc0000870.1_g000071 Rmu_sc0000870.1_g000072 Rmu_sc0001648.1_g000026 Rmu_sc0001648.1_g000043 Rmu_sc0001972.1_g000009 Rmu_sc0002109.1_g000009 Rmu_sc0003340.1_g000008 Rmu_sc0003340.1_g000009 Rmu_sc0004874.1_g000014 Rmu_sc0005823.1_g000009 Rmu_sc0005941.1_g000006 Rmu_sc0009850.1_g000015 Rmu_sc0015511.1_g000012
rosa_roxburghii Rroxscaffold_1G00034320 Rroxscaffold_1G00036130 Rroxscaffold_1G00043440 Rroxscaffold_1G00043450 Rroxscaffold_1G00050660 Rroxscaffold_1G00050670 Rroxscaffold_1G00066940 Rroxscaffold_2G00094100 Rroxscaffold_2G00120240 Rroxscaffold_4G00287900 Rroxscaffold_4G00287910 Rroxscaffold_4G00290700 Rroxscaffold_4G00290710 Rroxscaffold_4G00298640 Rroxscaffold_4G00308540 Rroxscaffold_5G00369420 Rroxscaffold_7G00217900
rosa_rugosa Rorug06G0077100
rosa_samantha Rh1AG005600 Rh1AG005700 Rh1BG433000 Rh1DG003900 Rh2CG286600 Rh3AG243900 Rh3BG368800 Rh5AG301800 Rh5BG309500 Rh5CG501500 Rh5CG501600 Rh5DG320200 Rh6AG179500 Rh6CG338800 Rh6CG405000 Rh6DG092100 Rh7AG294100 Rh7CG239600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 64
AclWI GGATC 1 cut(s) 217
AcsI RAATTY 1 cut(s) 361
AgsI TTSAA 3 cut(s) 24, 311, 317
AjnI CCWGG 1 cut(s) 372
AluBI AGCT 3 cut(s) 28, 41, 83
AluI AGCT 3 cut(s) 28, 41, 83
AlwI GGATC 1 cut(s) 217
ApoI RAATTY 1 cut(s) 361
ArsI GACNNNNNNTTYG 2 cut(s) 221, 253
AsuHPI GGTGA 3 cut(s) 106, 200, 248
BciT130I CCWGG 1 cut(s) 374
BclI TGATCA 1 cut(s) 253
BfaI CTAG 1 cut(s) 29
Bme1390I CCNGG 1 cut(s) 374
BmrFI CCNGG 1 cut(s) 374
BpuEI CTTGAG 2 cut(s) 152, 324
BsaXI ACNNNNNCTCC 2 cut(s) 314, 344
BseBI CCWGG 1 cut(s) 374
BseMII CTCAG 1 cut(s) 75
BsgI GTGCAG 1 cut(s) 246
BslFI GGGAC 1 cut(s) 137
BsmFI GGGAC 1 cut(s) 137
Bsp143I GATC 2 cut(s) 209, 253
BspCNI CTCAG 1 cut(s) 76
BspHI TCATGA 1 cut(s) 366
BspPI GGATC 1 cut(s) 217
BssMI GATC 2 cut(s) 209, 253
Bst2UI CCWGG 1 cut(s) 374
Bst6I CTCTTC 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 300
BstDEI CTNAG 2 cut(s) 84, 303
BstKTI GATC 2 cut(s) 212, 256
BstMBI GATC 2 cut(s) 209, 253
BstNI CCWGG 1 cut(s) 374
BstSCI CCNGG 1 cut(s) 372
BtsIMutI CAGTG 1 cut(s) 300
Cac8I GCNNGC 1 cut(s) 300
CciI TCATGA 1 cut(s) 366
CseI GACGC 1 cut(s) 134
CviAII CATG 2 cut(s) 138, 367
CviJI RGCY 4 cut(s) 28, 41, 83, 337
CviKI_1 RGCY 4 cut(s) 28, 41, 83, 337
DdeI CTNAG 2 cut(s) 84, 303
DpnI GATC 2 cut(s) 211, 255
DpnII GATC 2 cut(s) 209, 253
Eam1104I CTCTTC 1 cut(s) 9
EarI CTCTTC 1 cut(s) 9
Eco32I GATATC 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 372
EcoRV GATATC 1 cut(s) 106
FaeI CATG 2 cut(s) 141, 370
FaiI YATR 8 cut(s) 9, 139, 222, 261, 283, 285, 333, 368
FaqI GGGAC 1 cut(s) 137
FatI CATG 2 cut(s) 137, 366
FbaI TGATCA 1 cut(s) 253
FblI GTMKAC 1 cut(s) 64
FspBI CTAG 1 cut(s) 29
HgaI GACGC 1 cut(s) 134
Hin1II CATG 2 cut(s) 141, 370
HincII GTYRAC 1 cut(s) 78
HindII GTYRAC 1 cut(s) 78
HinfI GANTC 3 cut(s) 97, 134, 347
HpaI GTTAAC 1 cut(s) 78
HphI GGTGA 3 cut(s) 106, 200, 248
Hpy166II GTNNAC 2 cut(s) 65, 78
Hpy188III TCNNGA 3 cut(s) 101, 109, 367
Hpy8I GTNNAC 2 cut(s) 65, 78
HpyCH4V TGCA 1 cut(s) 227
HpyF3I CTNAG 2 cut(s) 84, 303
Hsp92II CATG 2 cut(s) 141, 370
Ksp22I TGATCA 1 cut(s) 253
KspAI GTTAAC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 209, 253
LpnPI CCDG 4 cut(s) 39, 77, 359, 386
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 3 cut(s) 148, 188, 272
MalI GATC 2 cut(s) 211, 255
MboI GATC 2 cut(s) 209, 253
MboII GAAGA 1 cut(s) 26
MluCI AATT 3 cut(s) 69, 193, 361
MlyI GAGTC 1 cut(s) 143
MnlI CCTC 5 cut(s) 4, 25, 321, 348, 375
MseI TTAA 3 cut(s) 77, 143, 180
MslI CAYNNNNRTG 1 cut(s) 293
MspA1I CMGCKG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 374
MvaI CCWGG 1 cut(s) 374
NdeII GATC 2 cut(s) 209, 253
NlaIII CATG 2 cut(s) 141, 370
NmuCI GTSAC 1 cut(s) 188
PagI TCATGA 1 cut(s) 366
PfeI GAWTC 2 cut(s) 97, 347
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 372
PspGI CCWGG 1 cut(s) 372
PsrI GAACNNNNNNTAC 2 cut(s) 151, 183
PvuII CAGCTG 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 293
SaqAI TTAA 3 cut(s) 77, 143, 180
Sau3AI GATC 2 cut(s) 209, 253
SchI GAGTC 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 374
SetI ASST 5 cut(s) 30, 43, 85, 332, 375
SmiMI CAYNNNNRTG 1 cut(s) 293
SmlI CTYRAG 2 cut(s) 131, 339
SmoI CTYRAG 2 cut(s) 131, 339
Sse9I AATT 3 cut(s) 69, 193, 361
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 372
TaqI TCGA 1 cut(s) 108
TasI AATT 3 cut(s) 69, 193, 361
TfiI GAWTC 2 cut(s) 97, 347
Tru1I TTAA 3 cut(s) 77, 143, 180
Tru9I TTAA 3 cut(s) 77, 143, 180
TscAI CASTG 1 cut(s) 300
TseFI GTSAC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 188
TspDTI ATGAA 2 cut(s) 355, 383
TspRI CASTG 1 cut(s) 300
XapI RAATTY 1 cut(s) 361
XmiI GTMKAC 1 cut(s) 64
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.