Rh6DG092100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0000779
Physical Location & Seq
Reverse (-)
10819071 .. 10831464
12394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG092100.1

Sequence Viewer

Length: 240 bp
ATGGATTACCAGGATAAGCAATCGCAATATACTTCAACTGGCCAACCAGAAGAGCAAATTGGGTCACTTCCATCTTCACAACCGGTGTCCTCTCCGATTATGACGATGGGCTCTATTCAAGAGCAAGCTATTGGTTGTTTCAGCACGATGGAGGAATGTCTTAGTGGTGTCAACCAAGGCATGCTCATGCTTCCTGATATTCACCCTCATCATACTGTGCCAAGGCATGAATTGCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.74

Weight (kDa)

4.81

Isoelectric Point (pI)

74.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000779)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g29862
rosa_chinensis RchiOBHm_Chr1g0313641 RchiOBHm_Chr4g0408161 RchiOBHm_Chr4g0408171 RchiOBHm_Chr4g0437611 RchiOBHm_Chr4g0437621 RchiOBHm_Chr4g0444671 RchiOBHm_Chr5g0045021 RchiOBHm_Chr5g0070121 RchiOBHm_Chr5g0082551 RchiOBHm_Chr6g0247501 RchiOBHm_Chr6g0271311 RchiOBHm_Chr6g0290811 RchiOBHm_Chr6g0310571
rosa_laevigata RLG00000004718 RLG00000008552 RLG00000015595
rosa_multiflora Rmu_co8342433.1_g000001 Rmu_sc0000147.1_g000080 Rmu_sc0000391.1_g000018 Rmu_sc0000753.1_g000021 Rmu_sc0000870.1_g000071 Rmu_sc0000870.1_g000072 Rmu_sc0001648.1_g000026 Rmu_sc0001648.1_g000043 Rmu_sc0001972.1_g000009 Rmu_sc0002109.1_g000009 Rmu_sc0003340.1_g000008 Rmu_sc0003340.1_g000009 Rmu_sc0004874.1_g000014 Rmu_sc0005823.1_g000009 Rmu_sc0005941.1_g000006 Rmu_sc0009850.1_g000015 Rmu_sc0015511.1_g000012
rosa_roxburghii Rroxscaffold_1G00034320 Rroxscaffold_1G00036130 Rroxscaffold_1G00043440 Rroxscaffold_1G00043450 Rroxscaffold_1G00050660 Rroxscaffold_1G00050670 Rroxscaffold_1G00066940 Rroxscaffold_2G00094100 Rroxscaffold_2G00120240 Rroxscaffold_4G00287900 Rroxscaffold_4G00287910 Rroxscaffold_4G00290700 Rroxscaffold_4G00290710 Rroxscaffold_4G00298640 Rroxscaffold_4G00308540 Rroxscaffold_5G00369420 Rroxscaffold_7G00217900
rosa_rugosa Rorug06G0077100
rosa_samantha Rh1AG005600 Rh1AG005700 Rh1BG433000 Rh1DG003900 Rh2CG286600 Rh3AG243900 Rh3BG368800 Rh5AG301800 Rh5BG309500 Rh5CG501500 Rh5CG501600 Rh5DG320200 Rh6AG179500 Rh6CG338800 Rh6CG405000 Rh6DG092100 Rh7AG294100 Rh7CG239600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 40
AgeI ACCGGT 1 cut(s) 82
AgsI TTSAA 2 cut(s) 36, 119
AjnI CCWGG 1 cut(s) 9
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AoxI GGCC 1 cut(s) 40
AsiGI ACCGGT 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 194
BalI TGGCCA 1 cut(s) 42
BanII GRGCYC 1 cut(s) 113
BccI CCATC 3 cut(s) 79, 100, 142
BciT130I CCWGG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
BsaJI CCNNGG 2 cut(s) 175, 221
BsaWI WCCGGW 1 cut(s) 82
Bse118I RCCGGY 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 43
BseBI CCWGG 1 cut(s) 11
BseDI CCNNGG 2 cut(s) 175, 221
BseNI ACTGG 1 cut(s) 43
BshFI GGCC 1 cut(s) 42
BshTI ACCGGT 1 cut(s) 82
BsiSI CCGG 1 cut(s) 83
BsnI GGCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 113
BspANI GGCC 1 cut(s) 42
BspQI GCTCTTC 1 cut(s) 45
BsrFI RCCGGY 1 cut(s) 82
BsrI ACTGG 1 cut(s) 43
BssAI RCCGGY 1 cut(s) 82
BssECI CCNNGG 2 cut(s) 175, 221
BssT1I CCWWGG 2 cut(s) 175, 221
Bst2UI CCWGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 217
Bst6I CTCTTC 1 cut(s) 45
BstAPI GCANNNNNTGC 1 cut(s) 232
BstC8I GCNNGC 2 cut(s) 126, 182
BstDEI CTNAG 1 cut(s) 161
BstMWI GCNNNNNNNGC 1 cut(s) 232
BstNI CCWGG 1 cut(s) 11
BstNSI RCATGY 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 9
BsuRI GGCC 1 cut(s) 42
Cac8I GCNNGC 2 cut(s) 126, 182
Cfr10I RCCGGY 1 cut(s) 82
CspAI ACCGGT 1 cut(s) 82
CviAII CATG 3 cut(s) 181, 187, 227
CviJI RGCY 3 cut(s) 42, 111, 128
CviKI_1 RGCY 3 cut(s) 42, 111, 128
DdeI CTNAG 1 cut(s) 161
EaeI YGGCCR 1 cut(s) 40
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
Eco130I CCWWGG 2 cut(s) 175, 221
Eco24I GRGCYC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 9
EcoT14I CCWWGG 2 cut(s) 175, 221
EcoT38I GRGCYC 1 cut(s) 113
ErhI CCWWGG 2 cut(s) 175, 221
FaeI CATG 3 cut(s) 184, 190, 230
FaiI YATR 6 cut(s) 30, 101, 182, 188, 213, 228
FatI CATG 3 cut(s) 180, 186, 226
FriOI GRGCYC 1 cut(s) 113
HaeIII GGCC 1 cut(s) 42
HapII CCGG 1 cut(s) 83
Hin1II CATG 3 cut(s) 184, 190, 230
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HpaII CCGG 1 cut(s) 83
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 2 cut(s) 119, 194
Hpy8I GTNNAC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4V TGCA 1 cut(s) 235
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
HpyF3I CTNAG 1 cut(s) 161
Hsp92II CATG 3 cut(s) 184, 190, 230
LguI GCTCTTC 1 cut(s) 45
LpnPI CCDG 5 cut(s) 23, 24, 60, 96, 207
MaeIII GTNAC 1 cut(s) 63
MboII GAAGA 2 cut(s) 62, 66
MhlI GDGCHC 1 cut(s) 113
MlsI TGGCCA 1 cut(s) 42
MluCI AATT 2 cut(s) 57, 230
MluNI TGGCCA 1 cut(s) 42
MnlI CCTC 3 cut(s) 100, 145, 216
Mox20I TGGCCA 1 cut(s) 42
MscI TGGCCA 1 cut(s) 42
MseI TTAA 1 cut(s) 238
MslI CAYNNNNRTG 1 cut(s) 185
Msp20I TGGCCA 1 cut(s) 42
MspI CCGG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 232
NlaIII CATG 3 cut(s) 184, 190, 230
NmuCI GTSAC 1 cut(s) 63
NspI RCATGY 1 cut(s) 184
PaeI GCATGC 1 cut(s) 184
PciSI GCTCTTC 1 cut(s) 45
PinAI ACCGGT 1 cut(s) 82
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 185
SapI GCTCTTC 1 cut(s) 45
SaqAI TTAA 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 11
SduI GDGCHC 1 cut(s) 113
SetI ASST 1 cut(s) 130
SmiMI CAYNNNNRTG 1 cut(s) 185
SphI GCATGC 1 cut(s) 184
Sse9I AATT 2 cut(s) 57, 230
StyD4I CCNGG 1 cut(s) 9
StyI CCWWGG 2 cut(s) 175, 221
TaaI ACNGT 1 cut(s) 217
TasI AATT 2 cut(s) 57, 230
Tru1I TTAA 1 cut(s) 238
Tru9I TTAA 1 cut(s) 238
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
XceI RCATGY 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.