Rh7CG239600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000779
Physical Location & Seq
Forward (+)
22370333 .. 22371426
1094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG239600.1

Sequence Viewer

Length: 447 bp
ATGGCTACTGAAGATCCTTCTTCAATTTCTCTTAAACTTGAGATGGGTCACATGGTAGAAACCAACATCTCTACTAAGCTAGTGGGTTTGGGGGGTGAAGACGAGGTGAATTCTCAAATTCATGGTGTGAATCCAGAACCAGTGGCCCAACCGTCTTGGTTGTTGAAGCAGACCGAACCACGAAAATTCAGGTTACATGATGGCAACGGAAACACAGGCATTTGCTACAACAGTAGCTTCGGCTCCCAAGAGAACGACAGTGATGTACGTCTAGTGCCTCCTATAGTTTATGAAGCTCTGAAAGGTCAAGAGACCATAGATTCAATTCATTCCTTGTGTTTAAAAACTCAGAGAAAGAAACTTATTTCTGAAAATGCTACTGAGGACTTTGTTAACCCTGCTGTCAATGTTAACGTTGATGTCAATCGTAATTCTGCTAATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.22

Weight (kDa)

5.01

Isoelectric Point (pI)

37.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000779)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g29862
rosa_chinensis RchiOBHm_Chr1g0313641 RchiOBHm_Chr4g0408161 RchiOBHm_Chr4g0408171 RchiOBHm_Chr4g0437611 RchiOBHm_Chr4g0437621 RchiOBHm_Chr4g0444671 RchiOBHm_Chr5g0045021 RchiOBHm_Chr5g0070121 RchiOBHm_Chr5g0082551 RchiOBHm_Chr6g0247501 RchiOBHm_Chr6g0271311 RchiOBHm_Chr6g0290811 RchiOBHm_Chr6g0310571
rosa_laevigata RLG00000004718 RLG00000008552 RLG00000015595
rosa_multiflora Rmu_co8342433.1_g000001 Rmu_sc0000147.1_g000080 Rmu_sc0000391.1_g000018 Rmu_sc0000753.1_g000021 Rmu_sc0000870.1_g000071 Rmu_sc0000870.1_g000072 Rmu_sc0001648.1_g000026 Rmu_sc0001648.1_g000043 Rmu_sc0001972.1_g000009 Rmu_sc0002109.1_g000009 Rmu_sc0003340.1_g000008 Rmu_sc0003340.1_g000009 Rmu_sc0004874.1_g000014 Rmu_sc0005823.1_g000009 Rmu_sc0005941.1_g000006 Rmu_sc0009850.1_g000015 Rmu_sc0015511.1_g000012
rosa_roxburghii Rroxscaffold_1G00034320 Rroxscaffold_1G00036130 Rroxscaffold_1G00043440 Rroxscaffold_1G00043450 Rroxscaffold_1G00050660 Rroxscaffold_1G00050670 Rroxscaffold_1G00066940 Rroxscaffold_2G00094100 Rroxscaffold_2G00120240 Rroxscaffold_4G00287900 Rroxscaffold_4G00287910 Rroxscaffold_4G00290700 Rroxscaffold_4G00290710 Rroxscaffold_4G00298640 Rroxscaffold_4G00308540 Rroxscaffold_5G00369420 Rroxscaffold_7G00217900
rosa_rugosa Rorug06G0077100
rosa_samantha Rh1AG005600 Rh1AG005700 Rh1BG433000 Rh1DG003900 Rh2CG286600 Rh3AG243900 Rh3BG368800 Rh5AG301800 Rh5BG309500 Rh5CG501500 Rh5CG501600 Rh5DG320200 Rh6AG179500 Rh6CG338800 Rh6CG405000 Rh6DG092100 Rh7AG294100 Rh7CG239600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 414
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 3 cut(s) 109, 117, 185
AcuI CTGAAG 1 cut(s) 30
AfaI GTAC 1 cut(s) 267
AgsI TTSAA 3 cut(s) 24, 166, 324
AluBI AGCT 3 cut(s) 79, 237, 296
AluI AGCT 3 cut(s) 79, 237, 296
Alw26I GTCTC 1 cut(s) 305
AlwI GGATC 1 cut(s) 8
AoxI GGCC 1 cut(s) 144
ApoI RAATTY 3 cut(s) 109, 117, 185
AspS9I GGNCC 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 107, 118
BbsI GAAGAC 1 cut(s) 105
BccI CCATC 2 cut(s) 37, 194
BcoDI GTCTC 1 cut(s) 305
BfaI CTAG 2 cut(s) 80, 272
BfmI CTRYAG 1 cut(s) 282
BmgT120I GGNCC 1 cut(s) 145
BmiI GGNNCC 1 cut(s) 244
BpiI GAAGAC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 59
BsaBI GATNNNNATC 1 cut(s) 423
BsaI GGTCTC 1 cut(s) 305
Bse1I ACTGG 1 cut(s) 140
Bse8I GATNNNNATC 1 cut(s) 423
BseJI GATNNNNATC 1 cut(s) 423
BseMII CTCAG 2 cut(s) 362, 372
BseNI ACTGG 1 cut(s) 140
BshFI GGCC 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 305
BsnI GGCC 1 cut(s) 146
Bso31I GGTCTC 1 cut(s) 305
Bsp143I GATC 1 cut(s) 13
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 2 cut(s) 361, 373
BspLI GGNNCC 1 cut(s) 244
BspPI GGATC 1 cut(s) 8
BspTNI GGTCTC 1 cut(s) 305
BsrI ACTGG 1 cut(s) 140
BssMI GATC 1 cut(s) 13
Bst4CI ACNGT 3 cut(s) 153, 233, 260
BstDEI CTNAG 3 cut(s) 75, 348, 381
BstKTI GATC 1 cut(s) 16
BstMAI GTCTC 1 cut(s) 305
BstMBI GATC 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 282
BstV2I GAAGAC 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 1 cut(s) 146
BtsIMutI CAGTG 2 cut(s) 147, 265
Cfr13I GGNCC 1 cut(s) 145
Csp6I GTAC 1 cut(s) 266
CviAII CATG 3 cut(s) 52, 122, 197
CviJI RGCY 6 cut(s) 5, 79, 146, 237, 243, 296
CviKI_1 RGCY 6 cut(s) 5, 79, 146, 237, 243, 296
CviQI GTAC 1 cut(s) 266
DdeI CTNAG 3 cut(s) 75, 348, 381
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
DraI TTTAAA 1 cut(s) 342
Eco31I GGTCTC 1 cut(s) 305
Eco57I CTGAAG 1 cut(s) 30
EcoRI GAATTC 1 cut(s) 109
FaeI CATG 3 cut(s) 55, 125, 200
FaiI YATR 6 cut(s) 53, 123, 198, 284, 291, 317
FatI CATG 3 cut(s) 51, 121, 196
FspBI CTAG 2 cut(s) 80, 272
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 3 cut(s) 55, 125, 200
HincII GTYRAC 2 cut(s) 394, 412
HindII GTYRAC 2 cut(s) 394, 412
HinfI GANTC 2 cut(s) 130, 320
HpaI GTTAAC 2 cut(s) 394, 412
HphI GGTGA 2 cut(s) 107, 118
Hpy166II GTNNAC 2 cut(s) 394, 412
Hpy188I TCNGA 3 cut(s) 300, 351, 370
Hpy188III TCNNGA 2 cut(s) 134, 308
Hpy8I GTNNAC 2 cut(s) 394, 412
HpyAV CCTTC 1 cut(s) 27
HpyCH4III ACNGT 3 cut(s) 153, 233, 260
HpyCH4IV ACGT 2 cut(s) 268, 414
HpyF3I CTNAG 3 cut(s) 75, 348, 381
HpySE526I ACGT 2 cut(s) 268, 414
Hsp92II CATG 3 cut(s) 55, 125, 200
KspAI GTTAAC 2 cut(s) 394, 412
Kzo9I GATC 1 cut(s) 13
LmnI GCTCC 1 cut(s) 248
LpnPI CCDG 5 cut(s) 147, 153, 175, 201, 411
MaeI CTAG 2 cut(s) 80, 272
MaeII ACGT 2 cut(s) 268, 414
MaeIII GTNAC 2 cut(s) 47, 192
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 3 cut(s) 12, 23, 110
MflI RGATCY 1 cut(s) 13
MluCI AATT 6 cut(s) 24, 109, 117, 185, 324, 430
MnlI CCTC 3 cut(s) 97, 288, 376
MseI TTAA 4 cut(s) 33, 341, 393, 411
NdeII GATC 1 cut(s) 13
NlaIII CATG 3 cut(s) 55, 125, 200
NlaIV GGNNCC 1 cut(s) 244
NmuCI GTSAC 1 cut(s) 47
PfeI GAWTC 2 cut(s) 130, 320
Psp1406I AACGTT 1 cut(s) 414
PspN4I GGNNCC 1 cut(s) 244
PspPI GGNCC 1 cut(s) 145
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 1 cut(s) 267
RsaNI GTAC 1 cut(s) 266
SaqAI TTAA 4 cut(s) 33, 341, 393, 411
Sau3AI GATC 1 cut(s) 13
Sau96I GGNCC 1 cut(s) 145
SetI ASST 8 cut(s) 81, 108, 194, 239, 271, 298, 307, 417
SfcI CTRYAG 1 cut(s) 282
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 6 cut(s) 24, 109, 117, 185, 324, 430
SspMI CTAG 2 cut(s) 80, 272
TaaI ACNGT 3 cut(s) 153, 233, 260
TaiI ACGT 2 cut(s) 271, 417
TaqII GACCGA 1 cut(s) 188
TasI AATT 6 cut(s) 24, 109, 117, 185, 324, 430
TfiI GAWTC 2 cut(s) 130, 320
Tru1I TTAA 4 cut(s) 33, 341, 393, 411
Tru9I TTAA 4 cut(s) 33, 341, 393, 411
TscAI CASTG 2 cut(s) 147, 265
TseFI GTSAC 1 cut(s) 47
Tsp45I GTSAC 1 cut(s) 47
TspDTI ATGAA 3 cut(s) 110, 306, 317
TspGWI ACGGA 1 cut(s) 222
TspRI CASTG 2 cut(s) 147, 265
XapI RAATTY 3 cut(s) 109, 117, 185
XspI CTAG 2 cut(s) 80, 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.