Rroxscaffold_1G00036130

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000779
Physical Location & Seq
Forward (+)
52762561 .. 52764748
2188 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00036130.1

Sequence Viewer

Length: 294 bp
ATGGGGGTTTGGCCATACTTGTTGAAAGAGAGTACTTTTCTTGCTTCTTTGGGGCCAACTATTGCAGGAGAAATTGGTGTATATGGTTATAAGCCTTTAGCTTTGGTAGATAAGCTTGCGTGTAAGAGGGTCGAAGTCAGCACAAAGCTTGGAGCATACATGAGAATCTCTAATTACAATGCCAACAATACCGATCAAACAAATTTCACAAGTTGGTTGTATGTTGATCCGAGGAAGCTGTCAAGGGACAATTATGGAGCTTATGTGATCCCCCAGGGAAGCCACCAGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PITH Peptidase_M16 Peptidase_M16_C

Protein Analysis

97

Amino Acids

10.84

Weight (kDa)

9.07

Isoelectric Point (pI)

12.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000779)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g29862
rosa_chinensis RchiOBHm_Chr1g0313641 RchiOBHm_Chr4g0408161 RchiOBHm_Chr4g0408171 RchiOBHm_Chr4g0437611 RchiOBHm_Chr4g0437621 RchiOBHm_Chr4g0444671 RchiOBHm_Chr5g0045021 RchiOBHm_Chr5g0070121 RchiOBHm_Chr5g0082551 RchiOBHm_Chr6g0247501 RchiOBHm_Chr6g0271311 RchiOBHm_Chr6g0290811 RchiOBHm_Chr6g0310571
rosa_laevigata RLG00000004718 RLG00000008552 RLG00000015595
rosa_multiflora Rmu_co8342433.1_g000001 Rmu_sc0000147.1_g000080 Rmu_sc0000391.1_g000018 Rmu_sc0000753.1_g000021 Rmu_sc0000870.1_g000071 Rmu_sc0000870.1_g000072 Rmu_sc0001648.1_g000026 Rmu_sc0001648.1_g000043 Rmu_sc0001972.1_g000009 Rmu_sc0002109.1_g000009 Rmu_sc0003340.1_g000008 Rmu_sc0003340.1_g000009 Rmu_sc0004874.1_g000014 Rmu_sc0005823.1_g000009 Rmu_sc0005941.1_g000006 Rmu_sc0009850.1_g000015 Rmu_sc0015511.1_g000012
rosa_roxburghii Rroxscaffold_1G00034320 Rroxscaffold_1G00036130 Rroxscaffold_1G00043440 Rroxscaffold_1G00043450 Rroxscaffold_1G00050660 Rroxscaffold_1G00050670 Rroxscaffold_1G00066940 Rroxscaffold_2G00094100 Rroxscaffold_2G00120240 Rroxscaffold_4G00287900 Rroxscaffold_4G00287910 Rroxscaffold_4G00290700 Rroxscaffold_4G00290710 Rroxscaffold_4G00298640 Rroxscaffold_4G00308540 Rroxscaffold_5G00369420 Rroxscaffold_7G00217900
rosa_rugosa Rorug06G0077100
rosa_samantha Rh1AG005600 Rh1AG005700 Rh1BG433000 Rh1DG003900 Rh2CG286600 Rh3AG243900 Rh3BG368800 Rh5AG301800 Rh5BG309500 Rh5CG501500 Rh5CG501600 Rh5DG320200 Rh6AG179500 Rh6CG338800 Rh6CG405000 Rh6DG092100 Rh7AG294100 Rh7CG239600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 90
AclWI GGATC 2 cut(s) 221, 262
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 1 cut(s) 202
AdeI CACNNNGTG 1 cut(s) 289
AfaI GTAC 1 cut(s) 34
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 273, 285
AluBI AGCT 5 cut(s) 101, 115, 148, 238, 260
AluI AGCT 5 cut(s) 101, 115, 148, 238, 260
AlwI GGATC 2 cut(s) 221, 262
AoxI GGCC 2 cut(s) 11, 53
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 1 cut(s) 53
BalI TGGCCA 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 275, 287
BmcAI AGTACT 1 cut(s) 34
Bme1390I CCNGG 2 cut(s) 275, 287
BmgT120I GGNCC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 2 cut(s) 275, 287
BsaJI CCNNGG 3 cut(s) 230, 273, 274
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
BseBI CCWGG 2 cut(s) 275, 287
BseDI CCNNGG 3 cut(s) 230, 273, 274
BshFI GGCC 2 cut(s) 13, 55
BslFI GGGAC 1 cut(s) 260
BsmFI GGGAC 1 cut(s) 260
BsnI GGCC 2 cut(s) 13, 55
Bsp143I GATC 3 cut(s) 193, 226, 267
BspANI GGCC 2 cut(s) 13, 55
BspLI GGNNCC 1 cut(s) 54
BspPI GGATC 2 cut(s) 221, 262
BssECI CCNNGG 3 cut(s) 230, 273, 274
BssMI GATC 3 cut(s) 193, 226, 267
Bst2UI CCWGG 2 cut(s) 275, 287
BstC8I GCNNGC 1 cut(s) 117
BstKTI GATC 3 cut(s) 196, 229, 270
BstMBI GATC 3 cut(s) 193, 226, 267
BstNI CCWGG 2 cut(s) 275, 287
BstSCI CCNGG 2 cut(s) 273, 285
BsuRI GGCC 2 cut(s) 13, 55
Cac8I GCNNGC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 53
CsiI ACCWGGT 1 cut(s) 285
Csp6I GTAC 1 cut(s) 33
CviAII CATG 1 cut(s) 160
CviJI RGCY 9 cut(s) 13, 55, 94, 101, 115, 148, 238, 260, 282
CviKI_1 RGCY 9 cut(s) 13, 55, 94, 101, 115, 148, 238, 260, 282
CviQI GTAC 1 cut(s) 33
DpnI GATC 3 cut(s) 195, 228, 269
DpnII GATC 3 cut(s) 193, 226, 267
DraIII CACNNNGTG 1 cut(s) 289
EaeI YGGCCR 1 cut(s) 11
EcoRII CCWGG 2 cut(s) 273, 285
FaeI CATG 1 cut(s) 163
FaiI YATR 9 cut(s) 16, 82, 84, 90, 157, 161, 222, 255, 264
FaqI GGGAC 1 cut(s) 260
FatI CATG 1 cut(s) 159
HaeIII GGCC 2 cut(s) 13, 55
Hin1II CATG 1 cut(s) 163
HindIII AAGCTT 2 cut(s) 113, 146
HinfI GANTC 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 65
Hsp92II CATG 1 cut(s) 163
Kzo9I GATC 3 cut(s) 193, 226, 267
LmnI GCTCC 2 cut(s) 152, 257
LpnPI CCDG 4 cut(s) 51, 260, 272, 287
MabI ACCWGGT 1 cut(s) 285
MalI GATC 3 cut(s) 195, 228, 269
MboI GATC 3 cut(s) 193, 226, 267
MlsI TGGCCA 1 cut(s) 13
MluCI AATT 4 cut(s) 72, 172, 202, 250
MluNI TGGCCA 1 cut(s) 13
MnlI CCTC 2 cut(s) 120, 225
Mox20I TGGCCA 1 cut(s) 13
MscI TGGCCA 1 cut(s) 13
Msp20I TGGCCA 1 cut(s) 13
MspR9I CCNGG 2 cut(s) 275, 287
MvaI CCWGG 2 cut(s) 275, 287
NdeII GATC 3 cut(s) 193, 226, 267
NlaIII CATG 1 cut(s) 163
NlaIV GGNNCC 1 cut(s) 54
PasI CCCWGGG 1 cut(s) 274
PfeI GAWTC 1 cut(s) 165
PsiI TTATAA 1 cut(s) 90
Psp6I CCWGG 2 cut(s) 273, 285
PspGI CCWGG 2 cut(s) 273, 285
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 53
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
Sau3AI GATC 3 cut(s) 193, 226, 267
Sau96I GGNCC 1 cut(s) 53
ScaI AGTACT 1 cut(s) 34
ScrFI CCNGG 2 cut(s) 275, 287
SetI ASST 6 cut(s) 103, 117, 150, 240, 262, 291
SexAI ACCWGGT 1 cut(s) 285
Sse9I AATT 4 cut(s) 72, 172, 202, 250
StyD4I CCNGG 2 cut(s) 273, 285
TaqI TCGA 1 cut(s) 132
TasI AATT 4 cut(s) 72, 172, 202, 250
TatI WGTACW 1 cut(s) 32
TfiI GAWTC 1 cut(s) 165
XapI RAATTY 1 cut(s) 202
ZrmI AGTACT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.