Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001972.1

Orthogroup ID

OG0000779

Physical Location & Seq

Genomic Coordinates Forward (+)

48127 .. 48471

Gene Structure 345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001972.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atgaattatgaggaagagatttcaaagctagaggcagaagctcaaaagaaaacagggagtggtggactaattgtggcatgcaatttaaacaatctcaaatcctttgtttcatattgcaattccatggctttcgtagctgatgattttgaaacaaccaacaatgaagacttcaaagtgctaggttctacactatgcaacagatattatgatcattcctcatcttctcaattcataattcccaacatctcagatgaatttcgatgccccaaaggtggacagaagcttattcacgtggcctttatacctaactatgcactgaagagtctattgcatcaatgttcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0002237 GO:0002682 GO:0002683 GO:0003674 GO:0003824 GO:0004842 GO:0005102 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0006464 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009608 GO:0009609 GO:0009610 GO:0009617 GO:0009620 GO:0009877 GO:0009987 GO:0010033 GO:0010941 GO:0016020 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0032446 GO:0033612 GO:0036211 GO:0036377 GO:0042221 GO:0042742 GO:0042981 GO:0043066 GO:0043067 GO:0043069 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044403 GO:0044419 GO:0044424 GO:0044444 GO:0044464 GO:0048519 GO:0048523 GO:0048580 GO:0048583 GO:0048585 GO:0050776 GO:0050777 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051239 GO:0051704 GO:0051707 GO:0060548 GO:0061630 GO:0061659 GO:0065007 GO:0070647 GO:0070696 GO:0071704 GO:0071944 GO:0098542 GO:0140096 GO:1901564 GO:2000026 GO:2000028 GO:2000241

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arm U-box

Protein Analysis

114

Amino Acids

12.74

Weight (kDa)

5.52

Isoelectric Point (pI)

30.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000779)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g29862
rosa_chinensis	RchiOBHm_Chr1g0313641 RchiOBHm_Chr4g0408161 RchiOBHm_Chr4g0408171 RchiOBHm_Chr4g0437611 RchiOBHm_Chr4g0437621 RchiOBHm_Chr4g0444671 RchiOBHm_Chr5g0045021 RchiOBHm_Chr5g0070121 RchiOBHm_Chr5g0082551 RchiOBHm_Chr6g0247501 RchiOBHm_Chr6g0271311 RchiOBHm_Chr6g0290811 RchiOBHm_Chr6g0310571
rosa_laevigata	RLG00000004718 RLG00000008552 RLG00000015595
rosa_multiflora	Rmu_co8342433.1_g000001 Rmu_sc0000147.1_g000080 Rmu_sc0000391.1_g000018 Rmu_sc0000753.1_g000021 Rmu_sc0000870.1_g000071 Rmu_sc0000870.1_g000072 Rmu_sc0001648.1_g000026 Rmu_sc0001648.1_g000043 Rmu_sc0001972.1_g000009 Rmu_sc0002109.1_g000009 Rmu_sc0003340.1_g000008 Rmu_sc0003340.1_g000009 Rmu_sc0004874.1_g000014 Rmu_sc0005823.1_g000009 Rmu_sc0005941.1_g000006 Rmu_sc0009850.1_g000015 Rmu_sc0015511.1_g000012
rosa_roxburghii	Rroxscaffold_1G00034320 Rroxscaffold_1G00036130 Rroxscaffold_1G00043440 Rroxscaffold_1G00043450 Rroxscaffold_1G00050660 Rroxscaffold_1G00050670 Rroxscaffold_1G00066940 Rroxscaffold_2G00094100 Rroxscaffold_2G00120240 Rroxscaffold_4G00287900 Rroxscaffold_4G00287910 Rroxscaffold_4G00290700 Rroxscaffold_4G00290710 Rroxscaffold_4G00298640 Rroxscaffold_4G00308540 Rroxscaffold_5G00369420 Rroxscaffold_7G00217900
rosa_rugosa	Rorug06G0077100
rosa_samantha	Rh1AG005600 Rh1AG005700 Rh1BG433000 Rh1DG003900 Rh2CG286600 Rh3AG243900 Rh3BG368800 Rh5AG301800 Rh5BG309500 Rh5CG501500 Rh5CG501600 Rh5DG320200 Rh6AG179500 Rh6CG338800 Rh6CG405000 Rh6DG092100 Rh7AG294100 Rh7CG239600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	254
AcuI	CTGAAG	1 cut(s)	338
AcvI	CACGTG	1 cut(s)	292
AfiI	CCNNNNNNNGG	1 cut(s)	272
AgsI	TTSAA	3 cut(s)	24, 149, 172
AluBI	AGCT	4 cut(s)	28, 41, 137, 283
AluI	AGCT	4 cut(s)	28, 41, 137, 283
AoxI	GGCC	1 cut(s)	294
ApoI	RAATTY	1 cut(s)	254
BbrPI	CACGTG	1 cut(s)	292
BbsI	GAAGAC	1 cut(s)	171
BclI	TGATCA	1 cut(s)	208
BfaI	CTAG	2 cut(s)	29, 179
BmsI	GCATC	2 cut(s)	251, 340
BpiI	GAAGAC	1 cut(s)	171
BsaAI	YACGTR	1 cut(s)	292
BsaJI	CCNNGG	1 cut(s)	123
Bsc4I	CCNNNNNNNGG	1 cut(s)	272
BseDI	CCNNGG	1 cut(s)	123
BseLI	CCNNNNNNNGG	1 cut(s)	272
BseMII	CTCAG	1 cut(s)	261
BshFI	GGCC	1 cut(s)	296
BslI	CCNNNNNNNGG	1 cut(s)	272
BsnI	GGCC	1 cut(s)	296
Bsp143I	GATC	1 cut(s)	208
Bsp19I	CCATGG	1 cut(s)	123
BspANI	GGCC	1 cut(s)	296
BspCNI	CTCAG	1 cut(s)	260
BssECI	CCNNGG	1 cut(s)	123
BssMI	GATC	1 cut(s)	208
BssT1I	CCWWGG	1 cut(s)	123
Bst6I	CTCTTC	2 cut(s)	9, 314
BstBAI	YACGTR	1 cut(s)	292
BstC8I	GCNNGC	1 cut(s)	79
BstDEI	CTNAG	1 cut(s)	247
BstDSI	CCRYGG	1 cut(s)	123
BstKTI	GATC	1 cut(s)	211
BstMBI	GATC	1 cut(s)	208
BstMWI	GCNNNNNNNGC	1 cut(s)	134
BstNSI	RCATGY	1 cut(s)	81
BstV2I	GAAGAC	1 cut(s)	171
BsuRI	GGCC	1 cut(s)	296
BtgI	CCRYGG	1 cut(s)	123
BtsIMutI	CAGTG	1 cut(s)	314
Cac8I	GCNNGC	1 cut(s)	79
CviAII	CATG	2 cut(s)	78, 124
CviJI	RGCY	6 cut(s)	28, 41, 128, 137, 283, 296
CviKI_1	RGCY	6 cut(s)	28, 41, 128, 137, 283, 296
DdeI	CTNAG	1 cut(s)	247
DpnI	GATC	1 cut(s)	210
DpnII	GATC	1 cut(s)	208
DraI	TTTAAA	1 cut(s)	87
Eam1104I	CTCTTC	2 cut(s)	9, 314
EarI	CTCTTC	2 cut(s)	9, 314
Eco130I	CCWWGG	1 cut(s)	123
Eco57I	CTGAAG	1 cut(s)	338
Eco72I	CACGTG	1 cut(s)	292
EcoT14I	CCWWGG	1 cut(s)	123
ErhI	CCWWGG	1 cut(s)	123
FaeI	CATG	2 cut(s)	81, 127
FaiI	YATR	9 cut(s)	9, 79, 112, 125, 193, 207, 233, 302, 312
FatI	CATG	2 cut(s)	77, 123
FbaI	TGATCA	1 cut(s)	208
FspBI	CTAG	2 cut(s)	29, 179
HaeIII	GGCC	1 cut(s)	296
Hin1II	CATG	2 cut(s)	81, 127
HindIII	AAGCTT	1 cut(s)	281
HinfI	GANTC	1 cut(s)	322
Hpy166II	GTNNAC	2 cut(s)	65, 275
Hpy188I	TCNGA	1 cut(s)	250
Hpy188III	TCNNGA	1 cut(s)	342
Hpy8I	GTNNAC	2 cut(s)	65, 275
HpyCH4IV	ACGT	1 cut(s)	291
HpyCH4V	TGCA	5 cut(s)	81, 117, 195, 314, 331
HpyF10VI	GCNNNNNNNGC	1 cut(s)	134
HpyF3I	CTNAG	1 cut(s)	247
HpySE526I	ACGT	1 cut(s)	291
Hsp92II	CATG	2 cut(s)	81, 127
Ksp22I	TGATCA	1 cut(s)	208
Kzo9I	GATC	1 cut(s)	208
LpnPI	CCDG	1 cut(s)	39
LweI	GCATC	2 cut(s)	251, 340
MaeI	CTAG	2 cut(s)	29, 179
MaeII	ACGT	1 cut(s)	291
MalI	GATC	1 cut(s)	210
MboI	GATC	1 cut(s)	208
MboII	GAAGA	4 cut(s)	26, 176, 213, 331
MluCI	AATT	7 cut(s)	4, 69, 82, 118, 227, 234, 254
MlyI	GAGTC	1 cut(s)	331
MnlI	CCTC	3 cut(s)	4, 25, 226
MseI	TTAA	1 cut(s)	86
MwoI	GCNNNNNNNGC	1 cut(s)	134
NcoI	CCATGG	1 cut(s)	123
NdeII	GATC	1 cut(s)	208
NlaIII	CATG	2 cut(s)	81, 127
NspI	RCATGY	1 cut(s)	81
PaeI	GCATGC	1 cut(s)	81
PleI	GAGTC	1 cut(s)	330
PmaCI	CACGTG	1 cut(s)	292
PmlI	CACGTG	1 cut(s)	292
PpsI	GAGTC	1 cut(s)	330
Ppu21I	YACGTR	1 cut(s)	292
PspCI	CACGTG	1 cut(s)	292
SaqAI	TTAA	1 cut(s)	86
Sau3AI	GATC	1 cut(s)	208
SchI	GAGTC	1 cut(s)	331
SetI	ASST	8 cut(s)	30, 43, 139, 184, 274, 285, 294, 307
SfaNI	GCATC	2 cut(s)	251, 340
SgeI	CNNG	7 cut(s)	41, 66, 90, 136, 191, 302, 304
SphI	GCATGC	1 cut(s)	81
Sse9I	AATT	7 cut(s)	4, 69, 82, 118, 227, 234, 254
SspMI	CTAG	2 cut(s)	29, 179
StyI	CCWWGG	1 cut(s)	123
TaiI	ACGT	1 cut(s)	294
TaqI	TCGA	1 cut(s)	259
TasI	AATT	7 cut(s)	4, 69, 82, 118, 227, 234, 254
Tru1I	TTAA	1 cut(s)	86
Tru9I	TTAA	1 cut(s)	86
TscAI	CASTG	1 cut(s)	321
TspDTI	ATGAA	5 cut(s)	17, 99, 177, 220, 267
TspRI	CASTG	1 cut(s)	321
XapI	RAATTY	1 cut(s)	254
XceI	RCATGY	1 cut(s)	81
XspI	CTAG	2 cut(s)	29, 179

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.